Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Expression plasmid with relatively high corynebacterium replication capability and construction method thereof

A technology for expressing plasmids and construction methods, which is applied in the field of expression plasmids and their construction, and can solve problems such as high cost, low copying ability, and low yield

Active Publication Date: 2020-04-17
SOUTH CHINA AGRI UNIV
View PDF8 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the research on biological metabolism and bacterial replication of coryneform bacteria is far less in-depth and comprehensive than that of E. The ability to copy directly leads to low yields and thus high costs, making it difficult to use in mass production
[0006] The applicant Tianjin University filed an invention patent application 201910636614.1 on July 15, 2019, disclosing a Corynebacterium glutamicum and its construction method for synthesizing geraniol And application, its construction method is: the mutant geranyl pyrophosphate synthase gene ERG20F96W-N127W of Saccharomyces cerevisiae source and the geraniol synthase gene tVoGES of valerian root truncated 53 amino acid residues of C terminal by fusion PCR The method is connected, and the homologous region is added with ribosome binding site sequence, inserted into the SacI and XbaI restriction sites of the expression plasmid pEC-XK99E of Corynebacterium glutamicum to obtain plasmid 1; plasmid 1 is transformed into Corynebacterium glutamicum, and obtained Corynebacterium glutamicum 1 for synthesizing geraniol; this invention provides more precursors for the synthesis of geraniol, the fermentation time is 42-48 hours shorter, and no corresponding by-products are detected by temperament detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expression plasmid with relatively high corynebacterium replication capability and construction method thereof
  • Expression plasmid with relatively high corynebacterium replication capability and construction method thereof
  • Expression plasmid with relatively high corynebacterium replication capability and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] This example mainly provides a method for constructing a coryneform bacteria expression plasmid in which the nucleotide C at the 1786th position of the plasmid pXMJ19 is mutated to A, including the following steps:

[0062] (1) Using the plasmid pXMJ19 (gifted by Bai Zhonghu Laboratory of Jiangnan University) as a template, the plasmid structure diagram is attached figure 1 As shown, primers were designed to amplify DNA fragment 1 with a length of 2282 bp and DNA fragment 2 with a length of 4351 bp to mutate the nucleotide C at the 1786th position of plasmid pXMJ19 to A by PCR;

[0063] The nucleotide sequences of the primers are as follows:

[0064] Construction of primers for DNA fragment 1

[0065] C1786A-F: gtttctacaaactcttttgtttatttttctaaatac (SEQ ID NO: 1)

[0066] C1786A-R: gtttgtagctcgcacgggggtttgt (SEQ ID NO: 2)

[0067] Construction of primers for DNA fragment 2

[0068] V-C1786A-F: ccgtgcgagctacaaactcatatgcac (SEQ ID NO: 3)

[0069] V-C1786A-R:agagtttgta...

Embodiment 2

[0084] This embodiment mainly provides a method for constructing a coryneform bacteria expression plasmid in which the nucleotide C at the 1786th position of the plasmid pXMJ19 is mutated to G, including the following steps:

[0085] (1) Using the plasmid pXMJ19 (gifted by Bai Zhonghu Laboratory of Jiangnan University) as a template, the plasmid structure diagram is attached figure 1 As shown, primers were designed to amplify DNA fragment 3 with a length of 2714 bp and DNA fragment 4 with a length of 3917 bp to mutate the nucleotide C at the 1786th position of plasmid pXMJ19 to G by PCR;

[0086] The nucleotide sequences of the primers are as follows:

[0087] Construction of primers for DNA fragment 3

[0088] C1786G-F: accgagctcgaattcagcttggc (SEQ ID NO: 5)

[0089] C1786G-R: agttcgtagctcgcacggg (SEQ ID NO: 6)

[0090] Construction of primers for DNA fragment 4

[0091] V-C1786G-F: tgcgagctacgaactcatatgcacg (SEQ ID NO: 7)

[0092] V-C1786G-R: gaattcgagctcggtacccgg (SEQ ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology, and particularly relates to an expression plasmid with relatively high corynebacterium replication capacity. The nucleotide of the 1786th siteof the expression plasmid is A or G, and the rest sites are the same as the corresponding sites of plasmid pXMJ19; the nucleotide sequence of the expression plasmid is shown as SEQ ID NO: 13 or SEQ IDNO: 14. According to a construction method, a corynebacterium replicon regulating part of a pXMJ19 vector is used for carrying out artificial mutation on the nucleotide C at the 1786th site; two strains of corynebacterium / escherichia coli dual-purpose vectors pXMJ19C1786A and pXMJ19C1786G plasmids, of which the copy capability is 6-8.5 times higher than that of the pXMJ19 plasmids, are successfully obtained; wherein the copy number of the pXMJ19C1786A plasmid is about 115, and the copy number of the pXMJ19C1786G plasmid is about 170.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to an expression plasmid with relatively high replication ability of coryneform bacteria and a construction method thereof. Background technique [0002] The biggest feature of a good genetically engineered vaccine is that it does not carry any infectious virus, so it will not cause toxic and side effects caused by virus infection, making it safer and more reliable. In addition, compared with the traditional vaccine production process, genetically engineered vaccines have the advantages of simpler, easier quality control, and easier storage and transportation. As a new type of biotechnology, the application of genetically engineered vaccines is constantly expanding, and has gradually become a new trend in the development of epidemic prevention and control in the economy and society. There are two main types of genetically engineered vaccines: one is nucleic acid vaccines in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/77C12N15/67
CPCC12N15/77C12N15/67
Inventor 陈瑞爱闫圆圆刘定祥黄梅
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products