Expression plasmid with relatively high corynebacterium replication capability and construction method thereof
A technology for expressing plasmids and construction methods, which is applied in the field of expression plasmids and their construction, and can solve problems such as high cost, low copying ability, and low yield
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0061] This example mainly provides a method for constructing a coryneform bacteria expression plasmid in which the nucleotide C at the 1786th position of the plasmid pXMJ19 is mutated to A, including the following steps:
[0062] (1) Using the plasmid pXMJ19 (gifted by Bai Zhonghu Laboratory of Jiangnan University) as a template, the plasmid structure diagram is attached figure 1 As shown, primers were designed to amplify DNA fragment 1 with a length of 2282 bp and DNA fragment 2 with a length of 4351 bp to mutate the nucleotide C at the 1786th position of plasmid pXMJ19 to A by PCR;
[0063] The nucleotide sequences of the primers are as follows:
[0064] Construction of primers for DNA fragment 1
[0065] C1786A-F: gtttctacaaactcttttgtttatttttctaaatac (SEQ ID NO: 1)
[0066] C1786A-R: gtttgtagctcgcacgggggtttgt (SEQ ID NO: 2)
[0067] Construction of primers for DNA fragment 2
[0068] V-C1786A-F: ccgtgcgagctacaaactcatatgcac (SEQ ID NO: 3)
[0069] V-C1786A-R:agagtttgta...
Embodiment 2
[0084] This embodiment mainly provides a method for constructing a coryneform bacteria expression plasmid in which the nucleotide C at the 1786th position of the plasmid pXMJ19 is mutated to G, including the following steps:
[0085] (1) Using the plasmid pXMJ19 (gifted by Bai Zhonghu Laboratory of Jiangnan University) as a template, the plasmid structure diagram is attached figure 1 As shown, primers were designed to amplify DNA fragment 3 with a length of 2714 bp and DNA fragment 4 with a length of 3917 bp to mutate the nucleotide C at the 1786th position of plasmid pXMJ19 to G by PCR;
[0086] The nucleotide sequences of the primers are as follows:
[0087] Construction of primers for DNA fragment 3
[0088] C1786G-F: accgagctcgaattcagcttggc (SEQ ID NO: 5)
[0089] C1786G-R: agttcgtagctcgcacggg (SEQ ID NO: 6)
[0090] Construction of primers for DNA fragment 4
[0091] V-C1786G-F: tgcgagctacgaactcatatgcacg (SEQ ID NO: 7)
[0092] V-C1786G-R: gaattcgagctcggtacccgg (SEQ ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com