Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

37 results about "Plasmid copy number" patented technology

Plasmids must regulate their copy number (average number of plasmid copies per cell) to ensure that they do not excessively burden the host or become lost during cell division. Plasmids may be either high copy number plasmids or low copy number plasmids; the regulation mechanisms between these two types are often significantly different. Biotechnology applications may involve engineering plasmids to allow a very high copy number. For example, pBR322 is a low copy number plasmid (~20 copies/cell) from which several very high copy number cloning vectors (~1000 copies/cell) have been derived.

Lac shuttle vectors

InactiveUS7026162B2BiocideBacteriaOrigin of replicationLactic acid bacterium
The invention discloses a Lac shuttle vector, comprising at least (a) a region which regulates a plasmid copy number; (b) an eukaryotic gene expression cassette, which comprises at least an eukaryotic gene transcriptional promoter sequence, a multiple cloning site and a transcriptional terminator sequence; (c) a lactic acid bacteria plasmid sequence, which comprises a plus origin of replication, and a nucleic acid sequence encoding for a protein which relates to the lactic acid bacteria plasmid replication; and (d) a non-antibiotic resistance selection gene and the promoter sequence thereof. The Lac shuttle vector features a non-antibiotic resistance gene as a selection marker, which is useful in pharmaceuticals and foods.
Owner:ANAWRAHTA BIOTECH

Absolute fluorescent quantitative polymerase chain reaction (PCR) primer pair, probe and method for determining growth titer of mycoplasma hyopneumoniae

The invention discloses an absolute fluorescent quantitative polymerase chain reaction (PCR) primer pair, an absolute fluorescent quantitative PCR probe and an absolute fluorescent quantitative PCR method for determining the growth titer of mycoplasma hyopneumoniae. The sequences of the absolute fluorescent quantitative PCR primer pair are shown as SEQ ID NO.1 and SEQ ID NO.2. The sequence of the absolute fluorescent quantitative PCR probe is shown as SEQ ID NO.3. The absolute fluorescent quantitative PCR method for determining the growth titer of the mycoplasma hyopneumoniae comprises the following steps: (1) extracting the deoxyribose nucleic acid (DNA) of the mycoplasma hyopneumoniae; (2) performing common PCR amplification to obtain a target fragment, and designing the absolute fluorescent quantitative PCR primer pair and the absolute fluorescent quantitative PCR probe in the middle of the target fragment; (3) preparing plasmids by connecting the target fragment and a PMD-18-T carrier, transfecting competent cells, and extracting plasmids of a positive bacteria solution; (4) calculating an initial plasmid copy number by using the plasmids extracted in the step (3) as standard substances; and (5) performing fluorescent quantitative PCR. According to the absolute fluorescent quantitative PCR method for determining the growth titer of the mycoplasma hyopneumoniae, the copy number of target genes, namely the growth titer of the mycoplasma hyopneumoniae, can be quickly and accurately determined.
Owner:WENS FOOD GRP CO LTD

Fluorescent quantitative PCR detection method for TLR3 (toll-like receptors) gene of duck

The invention provides a fluorescent quantitative PCR detection method for a TLR3 (toll-like receptors) gene of a duck. The detection method comprises the following steps: by taking a recombinant plasmid Peasy-T5-TLR3 as a template, screening the optimum concentration of a primer, a fluorescent quantitative PCR reaction system and a reaction condition; by taking the recombinant plasmid as a standard substance, determining the OD260 value; according to the molecular weight and the mass concentration, calculating the copy concentration, diluting, carrying out FQ-PCR amplification; by taking logarithm of the recombinant plasmid copy number as axis X and circulating number of times as axis Y, establishing a standard curve; repeatedly verifying 1.0*10<3>-1*10<8> copy / microliter recombinant plasmid; carrying out FQ-PCR detection on the recombinant plasmid; and carrying out double verification on the specificity of the detection method by virtue of sequence alignment of a sample and the standard substance and a peak pattern of a solubility curve of the sample.
Owner:SHANGHAI VETERINARY RES INST CHINESE ACAD OF AGRI SCI

Modification method of corynebacterium plasmid replicon and product of corynebacterium plasmid replicon

According to the invention, based on a pGA1 corynebacterium replicon in pEC-XK99E, which is a low-copy plasmid replicon with a copy number of about 30 in corynebacterium glutamicum, 325-site isoleucine of a replicating protein Rep is mutated into threonine, and 398-site amino acid for coding serine is changed into a synonymous codon, so that a replicon pGA1-Rep-I325T / S398 capable of increasing the plasmid copy number of corynebacterium is successfully obtained. The replicon is used for construction of high-copy plasmids, and after a plasmid pEC-XK99E-Rep-T / S carrying the pGA1-Rep-I325T / S398 replicon is replicated in corynebacterium glutamicum, it is proved that the number of plasmids in thalli is increased through plasmid in-vitro extraction. According to the method, pEC-XK99E-EGFP-Rep-T / S plasmids are constructed, fluorescence values under different thallus amounts are measured, and the fluorescence amount is increased by three times compared with that of mutant plasmids, namely, the expression amount of protein is increased by the modified plasmids. Meanwhile, by virtue of a fluorescent quantitative PCR means, the copy number after mutation is determined to be about 245 which is 8 times of that of a plasmid of a wild type replicon.
Owner:JIANGNAN UNIV

Broad host range pBBR1-based plasmid mutant derivatives having altered plasmid copy number

InactiveUS20050130307A1Short timeEffective levelingSugar derivativesBacteriaEukaryotic plasmidsPlasmid copy number
The present invention describes a mutant plasmid replication control region having the ability to convey a phenotype of altered plasmid copy number to the plasmid on which it resides. The mutant replication control region is based on a similar region isolated from the pBBR1 plasmid family. Plasmids containing this replication control region cannot be classed as belonging to any known incompatibility group and thus may co-exist with a broad range of other plasmids in a single host.
Owner:EI DU PONT DE NEMOURS & CO

Culture medium for inducing plasmid copy number increase and application thereof

The invention provides a culture medium for inducing plasmid copy number increase and an application thereof. The culture medium for inducing the plasmid copy number increase has the advantages that plasmid extraction concentration is improved by 45-95% in comparison with that of a traditional plasmid copy number induction method, and the plasmid extraction concentration is improved by 110-440% incomparison with that of a culture medium induction method free of glucose and arabinose. The culture medium plays very important roles in induction of the plasmid copy number increase and implementation of high throughput production.
Owner:JIANGSU GENSCRIPT BIOTECH CO LTD

Compositions and processes for improved plasmid DNA production

ActiveUS20100167358A1Improve plasmid DNA production yieldImprove production yieldBacteriaFermentationPlasmid dnaPlasmid copy number
Improvements in plasmid DNA production technology are needed to insure the economic feasibility of future DNA vaccines and DNA therapeutics. General methods are described, by means of which it is possible to dramatically increase plasmid DNA productivity. These processes feature RNA based inducers of plasmid copy number.
Owner:ALDEVRON LLC

Broad host range pBBR1-based plasmid mutant derivatives having altered plasmid copy number

InactiveUS7247467B2Effective levelingShort timeBacteriaSugar derivativesPlasmid copy numberBiochemistry
The present invention describes a mutant plasmid replication control region having the ability to convey a phenotype of altered plasmid copy number to the plasmid on which it resides. The mutant replication control region is based on a similar region isolated from the pBBR1 plasmid family. Plasmids containing this replication control region cannot be classed as belonging to any known incompatibility group and thus may co-exist with a broad range of other plasmids in a single host.
Owner:EI DU PONT DE NEMOURS & CO

PCR detection primers and detection method for musk-derived ingredients

The invention discloses PCR detection primers and a detection method for musk-derived ingredients. The sequences of the primer pair are as shown in F-primer: TGGAGCTTTAACTAACTAGCCT, and R-primer: TGGATCAATGAGCGATATTGTG. According to the invention, the pair of specific primers is designed in a highly conserved domain in accordance with musk mitochondrion DNA (mtDNA) sequences revealed in GenBank; experimental results show that the primers are relatively good in specificity, specific amplification can be conducted on musk samples while cannot be conducted on other animal samples (including deer animals); and the primers are relatively high in sensitivity and are capable of detecting 102 copies / [micron]L according to the minimal order of plasmid copy magnitude. The method is applicable to rapid identification of common musk-derived ingredients on the market.
Owner:珠海出入境检验检疫局检验检疫技术中心

Mutations affecting plasmid copy number

InactiveUS7291482B2BacteriaFermentationAnti-Sense RNAPlasmid copy number
Mutations in chromosomal genes have been identified that affect plasmid copy number in plasmids that are anti-sense RNA regulated such as the pMB1-derived and p15A-derived plasmids.
Owner:EI DU PONT DE NEMOURS & CO

Nucleic Acid Molecules Comprising a Variant inc Coding Strand

A nucleic acid molecule comprising a variant inc coding strand is disclosed as a regulator of plasmid copy number. Also disclosed is a replicon comprising the nucleic acid molecule, a promoter, and an origin of replication. Also disclosed is a vector comprising the replicon. Also disclosed is a recombinant microorganism comprising the vector.
Owner:CJ CHEILJEDANG CORP

Compositions and Methods for Controlling Copy Number for a Broad Range of Plasmids and Uses Thereof

InactiveUS20100323400A1Transcribe the DNA quicklyLittle effectBacteriaFermentationHeterologousGenetics
The present invention provides compositions and methods for controlling the copy number for a broad range of plasmids and uses thereof. Disclosed is a host cell for conditional control of copy number of a plasmid, which host cell comprises a poly(A) polymerase gene that is operably joined to a conditionally inducible promoter, and a method for cloning and stably maintaining a DNA sequence encoding a heterologous polypeptide in the host cell.
Owner:ILLUMINA INC

Method for controlling plasmid copy number in e.coli

InactiveUS20110269184A1Function of the RNAI promoter is abolished orLoad minimizationBacteriaFermentationEscherichia coliVector system
Host vector system and methods for plasmid DNA and recombinant protein production. The system allows copy number control of a ColE1 plasmid in E. coli by an RNA molecule that is transcribed from the host's genome and that interacts with plasmid-transcribed RNAI or RNAII. The system can be extended to combine PCN control and antibiotic-free selection.
Owner:BOEHRINGER INGELHEIM RCV GMBH & CO KG

Expression plasmid with relatively high corynebacterium replication capability and construction method thereof

The invention belongs to the technical field of biology, and particularly relates to an expression plasmid with relatively high corynebacterium replication capacity. The nucleotide of the 1786th siteof the expression plasmid is A or G, and the rest sites are the same as the corresponding sites of plasmid pXMJ19; the nucleotide sequence of the expression plasmid is shown as SEQ ID NO: 13 or SEQ IDNO: 14. According to a construction method, a corynebacterium replicon regulating part of a pXMJ19 vector is used for carrying out artificial mutation on the nucleotide C at the 1786th site; two strains of corynebacterium / escherichia coli dual-purpose vectors pXMJ19C1786A and pXMJ19C1786G plasmids, of which the copy capability is 6-8.5 times higher than that of the pXMJ19 plasmids, are successfully obtained; wherein the copy number of the pXMJ19C1786A plasmid is about 115, and the copy number of the pXMJ19C1786G plasmid is about 170.
Owner:SOUTH CHINA AGRI UNIV

Novel cloning vector pATC4185

InactiveCN103602698ASmall molecular weightIncrease plasmid copy numberVector-based foreign material introductionAmpicillinResistant genes
The invention relates to an insertional inactivation type cloning vector pATC 4185 with ampicillin and tetracycline resistant genes. The vector is obtained by the following steps: removing the Rop gene on pBR322 by double digestion method, filling in the end and looping internally. pATC4185 not only preserves the insertional inactivation screening mark of pBR322, but also has smaller molecular weight and higher stability, and the plasmid copy number increases more than three times, and the product is convenient for gene clone operation with higher operating efficiency. The product can replace pBR322 plasmid which is widely used at present, and is used as a general high efficiency cloning vector.
Owner:YUNNAN AGRICULTURAL UNIVERSITY

High copy number self-replicating plasmids in pseudomonas

InactiveUS20090162898A1High copy numberIncrease plasmid copy numberBacteriaUnicellular algaeSelect agentPseudomonas tolaasii
Provided herein are improved copy number plasmids, particularly those plasmids capable of replication in a bacterial cell. The improved copy number plasmid contain a deletion, insertion, or substitution in the replication control region, particularly a Pseudomonas-specific replication control region, that results in an increase in plasmid copy number in comparison to a control plasmid. Also provided are host cells containing the improved copy number plasmids, as well as methods of using the improved copy number plasmids for the recombinant production of a protein of interest. Further provided are methods for generating plasmids with improved copy number. The methods disclosed herein involve the reiterative selection of improved copy number plasmids by the growth and selection of plasmids capable of growth under increasing selective pressure, wherein the selective pressure is applied utilizing a selection agent to which the control plasmid confers resistance.
Owner:PFENEX

Plasmid vector capable of easily detecting plasmid copy number and detection kit thereof

The invention relates to a plasmid vector capable of easily detecting the copy number of plasmids and a detection kit thereof. According to the plasmid vector, a plasmid replicon ORI gene and a single copy conserved gene of an escherichia coli genome are constructed on the same plasmid. The detection kit contains the plasmid vector or a single-copy quality control product prepared from the plasmid vector. The method has the advantages of high detection result accuracy, high reproducibility and simple detection process, and effectively solves the related problems existing in the traditional escherichia coli plasmid copy number detection method.
Owner:SUZHOU LEVOSTAR LIFE SCIENCES CO LTD

Escherichia coli strain capable of bidirectionally regulating CoIE1 type plasmid copy number and application thereof

The invention discloses an Escherichia coli strain capable of bidirectionally regulating the copy number of CoIE1 type plasmids and application of the Escherichia coli strain. According to the method, escherichia coli Mach1-T1 is taken as an initial strain, a CRISPR / CAS9 gene editing technology is utilized, RNase E Q36R variant genes, rssB genes and pcnb genes are constructed into a polycistron expression cassette, and the polycistron expression cassette is placed under the control of an arabinose operon to replace endogenous pcnb genes of a genome. Each gene in the polycistron expression cassette is driven to translate by an independent ribosome binding site (RBS). By adjusting the concentration of the arabinose, continuous and bidirectional regulation and control of the copy number of the CoIE1 type plasmids from'inhibition 'to'overproduction' can be realized, and the method has important significance on industrial mass production of the CoIE1 type plasmids and diversified application of the CoIE1 type plasmids.
Owner:SUZHOU HONGXUN BIOTECH CO LTD

Orthogonal linear gene expression system and use thereof

ActiveCN116004693BBacteriaMicroorganism based processesSynthetic biologyPlasmid copy number
The application discloses a kind of orthogonal linear gene expression system and application, belong to genetic engineering field.The application is with Bacillus thuringiensis as expression host, realizes the stable expression of gene by constructing linear plasmid in cell.Meanwhile, the application also realizes the accurate control of linear plasmid copy number.This not only develops a stable protein expression system in Bacillus thuringiensis, but also lays a foundation for Bacillus thuringiensis synthetic biology application.
Owner:JIANGNAN UNIV

A new cloning vector patc4185

The invention relates to an insertional inactivation type cloning vector pATC 4185 with ampicillin and tetracycline resistant genes. The vector is obtained by the following steps: removing the Rop gene on pBR322 by double digestion method, filling in the end and looping internally. pATC4185 not only preserves the insertional inactivation screening mark of pBR322, but also has smaller molecular weight and higher stability, and the plasmid copy number increases more than three times, and the product is convenient for gene clone operation with higher operating efficiency. The product can replace pBR322 plasmid which is widely used at present, and is used as a general high efficiency cloning vector.
Owner:YUNNAN AGRICULTURAL UNIVERSITY

High copy number self-replicating plasmids in pseudomonas

InactiveUS8318481B2BacteriaUnicellular algaeSelect agentPseudomonas tolaasii
Provided herein are improved copy number plasmids, particularly those plasmids capable of replication in a bacterial cell. The improved copy number plasmid contain a deletion, insertion, or substitution in the replication control region, particularly a Pseudomonas-specific replication control region, that results in an increase in plasmid copy number in comparison to a control plasmid. Also provided are host cells containing the improved copy number plasmids, as well as methods of using the improved copy number plasmids for the recombinant production of a protein of interest. Further provided are methods for generating plasmids with improved copy number. The methods disclosed herein involve the reiterative selection of improved copy number plasmids by the growth and selection of plasmids capable of growth under increasing selective pressure, wherein the selective pressure is applied utilizing a selection agent to which the control plasmid confers resistance.
Owner:PFENEX

Cold-shock expression T-vector and application method thereof

InactiveCN105505968AAddress degenerationAddressing Cytotoxicity IssuesVector-based foreign material introductionBiotechnologyHeterologous
The invention provides a cold-shock expression T-vector and an application method thereof. Proteins coded by genes of animals, plants and normal temperature microbes are not stable, and most of the proteins are denaturated within a plurality of hours after heterogeneous expression; and proteins have inhibitory or poisoning effect on growth of recombinant cells, so recombinant expression is difficult to realize. The novel T-vector designed and constructed in the invention has the following characteristics: (1) the T-vector expresses an exogenous gene in a low temperature environment and can effectively prevent protein denaturation or reduce cytotoxicity; (2) the T-vector has mall plasmid molecular weight and the characteristics of great gene capacity, a high conversion rate, etc., and can improve gene cloning efficiency; (3) a plasmid copy number is high, so the level of expression is further increased; and (4) through combination with TA cloning technology and a low temperature expression function, the constructed T-vector is applicable to library construction and activity screening. As the vector provided by the invention is used for PCR cloning of coding genes of proteins with lability or cytotoxicity, construction and screening of a gene library and over-expression of the genes, operation steps can be simplified, materials and time can be saved, and the accuracy and success rate of testing can be improved.
Owner:邵蔚蓝

A modular construction method of a high-titer lanM protein production engineering strain

PendingCN122629098ABiotechnologyAmino acid synthesis
The application belongs to the technical field of genetic engineering and microbial metabolic engineering, and particularly relates to a modular construction method of a high-titer LanM protein engineering strain. The construction method realizes high-level soluble expression of LanM protein in Escherichia coli through four-dimensional modular synergistic regulation of spatial positioning optimization, chaperone-assisted folding, central carbon metabolic flow redistribution and amino acid synthesis strengthening. The system not only improves the yield of the target protein, but also provides a technical reference for the heterologous expression of other metal-binding proteins with similar structural characteristics. Through the synergy of plasmid copy number control, promoter strength matching and induction timing between the modules, the dynamic balance of intracellular metabolic flow and protein synthesis flow is achieved, meeting the requirements of industrial large-scale production.
Owner:TIANJIN UNIV

Promoter library and strong promoter for amylase BLA

The invention relates to a promoter library which is used for efficiently expressing amylase BLA in bacillus subtilis. A probe vector of the library is an integrated vector to avoid influence of plasmid copy number on library characterization; a strong transcription terminator is arranged on each of upstream and downstream of a BLA expression frame to avoid influence of upstream and downstream genetic elements on BLA expression. A building method of the library includes: oligonucleotide annealing and simultaneous enzyme digestion and enzyme linking of IIs-type restriction enzyme and ligase. Inorder to improve integration efficiency of the probe vector and lowering background of endogenous amylase AmyE, when the promoter library converts bacillus subtilis, a CRISPR / cas9 system is used to introduce DNA double-strand break at an integration site. After conversion, the promoter library is coated on a substrate flat plate, converters with large hydrolysis circles are re-screened through a96-well plate, and strong converters after re-screening are further re-screened through a shake flask. Through the above steps, 22 promoters with higher BLA expression efficiency than P43, in which 7hybrid promoters are higher than all starting promoters in strength.
Owner:QINGDAO VLAND BIOTECH GRP

A kind of absolute fluorescent quantitative PCR primer pair, probe and method for measuring the growth titer of mycoplasma hyopneumoniae

The invention discloses an absolute fluorescent quantitative polymerase chain reaction (PCR) primer pair, an absolute fluorescent quantitative PCR probe and an absolute fluorescent quantitative PCR method for determining the growth titer of mycoplasma hyopneumoniae. The sequences of the absolute fluorescent quantitative PCR primer pair are shown as SEQ ID NO.1 and SEQ ID NO.2. The sequence of the absolute fluorescent quantitative PCR probe is shown as SEQ ID NO.3. The absolute fluorescent quantitative PCR method for determining the growth titer of the mycoplasma hyopneumoniae comprises the following steps: (1) extracting the deoxyribose nucleic acid (DNA) of the mycoplasma hyopneumoniae; (2) performing common PCR amplification to obtain a target fragment, and designing the absolute fluorescent quantitative PCR primer pair and the absolute fluorescent quantitative PCR probe in the middle of the target fragment; (3) preparing plasmids by connecting the target fragment and a PMD-18-T carrier, transfecting competent cells, and extracting plasmids of a positive bacteria solution; (4) calculating an initial plasmid copy number by using the plasmids extracted in the step (3) as standard substances; and (5) performing fluorescent quantitative PCR. According to the absolute fluorescent quantitative PCR method for determining the growth titer of the mycoplasma hyopneumoniae, the copy number of target genes, namely the growth titer of the mycoplasma hyopneumoniae, can be quickly and accurately determined.
Owner:WENS FOODSTUFF GRP CO LTD

Primers, method and kit for detecting carbapenemase blaKPC gene

The invention belongs to the technical field of molecular biology, and particularly relates to primers, a method and a kit for detecting carbapenemase blaKPC gene subtypes. The invention provides a group of primers capable of specifically amplifying all gene subtypes of carbapenemase blaKPC, and a corresponding detection method and a kit are designed on the basis of the primers. The kit and the method for detecting carbapenemase blaKPC gene subtypes have the characteristics of rapidness, accuracy, simplicity in operation and the like, and can detect all the gene subtypes of blaKPC gene family;the detection specificity is high, and cross reaction with other non-target genes or human genes is avoided; the sensitivity is high, and the lowest detection limit determined according to the plasmid copy number is 100 copies per reaction. The kit and the method can be used for quantitatively detecting all genotypes of carbapenemase-resistant blaKPC family in vitro, provide a theoretical basis for clinical determination of infection resistance, and provide a reference method for molecular epidemiological research on carbapenemase.
Owner:NANFANG HOSPITAL OF SOUTHERN MEDICAL UNIV

Fluorescence quantitative pcr detection method of a kind of duck tlr3 gene

The invention provides a fluorescent quantitative PCR detection method for a TLR3 (toll-like receptors) gene of a duck. The detection method comprises the following steps: by taking a recombinant plasmid Peasy-T5-TLR3 as a template, screening the optimum concentration of a primer, a fluorescent quantitative PCR reaction system and a reaction condition; by taking the recombinant plasmid as a standard substance, determining the OD260 value; according to the molecular weight and the mass concentration, calculating the copy concentration, diluting, carrying out FQ-PCR amplification; by taking logarithm of the recombinant plasmid copy number as axis X and circulating number of times as axis Y, establishing a standard curve; repeatedly verifying 1.0*10<3>-1*10<8> copy / microliter recombinant plasmid; carrying out FQ-PCR detection on the recombinant plasmid; and carrying out double verification on the specificity of the detection method by virtue of sequence alignment of a sample and the standard substance and a peak pattern of a solubility curve of the sample.
Owner:SHANGHAI VETERINARY RES INST CHINESE ACAD OF AGRI SCI

A kind of pcr detection primer and detection method of musk deer-derived components

The invention discloses PCR detection primers and a detection method for musk-derived ingredients. The sequences of the primer pair are as shown in F-primer: TGGAGCTTTAACTAACTAGCCT, and R-primer: TGGATCAATGAGCGATATTGTG. According to the invention, the pair of specific primers is designed in a highly conserved domain in accordance with musk mitochondrion DNA (mtDNA) sequences revealed in GenBank; experimental results show that the primers are relatively good in specificity, specific amplification can be conducted on musk samples while cannot be conducted on other animal samples (including deer animals); and the primers are relatively high in sensitivity and are capable of detecting 102 copies / [micron]L according to the minimal order of plasmid copy magnitude. The method is applicable to rapid identification of common musk-derived ingredients on the market.
Owner:珠海出入境检验检疫局检验检疫技术中心

A new cloning vector pat3733

The invention relates to an insertional inactivation type cloning vector pAT 3733 with ampicillin and tetracycline resistant genes. The vector is obtained by the following steps: removing the Rop gene on pBR322 by double digestion method, filling in the end and looping internally. pAT3733 not only preserves the insertional inactivation screening mark of pBR322, but also has smaller molecular weight and higher stability, and the plasmid copy number increases more than three times, and the product is convenient for gene clone operation with higher operating efficiency. The product can replace pBR322 plasmid which is widely used at present, and is used as a general high efficiency cloning vector.
Owner:YUNNAN AGRICULTURAL UNIVERSITY