31 results about "Plasmid copy number" patented technology

The invention discloses a Lac shuttle vector, comprising at least (a) a region which regulates a plasmid copy number; (b) an eukaryotic gene expression cassette, which comprises at least an eukaryotic gene transcriptional promoter sequence, a multiple cloning site and a transcriptional terminator sequence; (c) a lactic acid bacteria plasmid sequence, which comprises a plus origin of replication, and a nucleic acid sequence encoding for a protein which relates to the lactic acid bacteria plasmid replication; and (d) a non-antibiotic resistance selection gene and the promoter sequence thereof. The Lac shuttle vector features a non-antibiotic resistance gene as a selection marker, which is useful in pharmaceuticals and foods.

The present invention describes a mutant plasmid replication control region having the ability to convey a phenotype of altered plasmid copy number to the plasmid on which it resides. The mutant replication control region is based on a similar region isolated from the pBBR1 plasmid family. Plasmids containing this replication control region cannot be classed as belonging to any known incompatibility group and thus may co-exist with a broad range of other plasmids in a single host.

The invention relates to an insertional inactivation type cloning vector pATC 4185 with ampicillin and tetracycline resistant genes. The vector is obtained by the following steps: removing the Rop gene on pBR322 by double digestion method, filling in the end and looping internally. pATC4185 not only preserves the insertional inactivation screening mark of pBR322, but also has smaller molecular weight and higher stability, and the plasmid copy number increases more than three times, and the product is convenient for gene clone operation with higher operating efficiency. The product can replace pBR322 plasmid which is widely used at present, and is used as a general high efficiency cloning vector.

Improvements in plasmid DNA production technology are needed to insure the economic feasibility of future DNA vaccines and DNA therapeutics. General methods are described, by means of which it is possible to dramatically increase plasmid DNA productivity. These processes feature RNA based inducers of plasmid copy number.

Provided herein are improved copy number plasmids, particularly those plasmids capable of replication in a bacterial cell. The improved copy number plasmid contain a deletion, insertion, or substitution in the replication control region, particularly a Pseudomonas-specific replication control region, that results in an increase in plasmid copy number in comparison to a control plasmid. Also provided are host cells containing the improved copy number plasmids, as well as methods of using the improved copy number plasmids for the recombinant production of a protein of interest. Further provided are methods for generating plasmids with improved copy number. The methods disclosed herein involve the reiterative selection of improved copy number plasmids by the growth and selection of plasmids capable of growth under increasing selective pressure, wherein the selective pressure is applied utilizing a selection agent to which the control plasmid confers resistance.

The invention discloses an absolute fluorescent quantitative polymerase chain reaction (PCR) primer pair, an absolute fluorescent quantitative PCR probe and an absolute fluorescent quantitative PCR method for determining the growth titer of mycoplasma hyopneumoniae. The sequences of the absolute fluorescent quantitative PCR primer pair are shown as SEQ ID NO.1 and SEQ ID NO.2. The sequence of the absolute fluorescent quantitative PCR probe is shown as SEQ ID NO.3. The absolute fluorescent quantitative PCR method for determining the growth titer of the mycoplasma hyopneumoniae comprises the following steps: (1) extracting the deoxyribose nucleic acid (DNA) of the mycoplasma hyopneumoniae; (2) performing common PCR amplification to obtain a target fragment, and designing the absolute fluorescent quantitative PCR primer pair and the absolute fluorescent quantitative PCR probe in the middle of the target fragment; (3) preparing plasmids by connecting the target fragment and a PMD-18-T carrier, transfecting competent cells, and extracting plasmids of a positive bacteria solution; (4) calculating an initial plasmid copy number by using the plasmids extracted in the step (3) as standard substances; and (5) performing fluorescent quantitative PCR. According to the absolute fluorescent quantitative PCR method for determining the growth titer of the mycoplasma hyopneumoniae, the copy number of target genes, namely the growth titer of the mycoplasma hyopneumoniae, can be quickly and accurately determined.

The invention discloses PCR detection primers and a detection method for musk-derived ingredients. The sequences of the primer pair are as shown in F-primer: TGGAGCTTTAACTAACTAGCCT, and R-primer: TGGATCAATGAGCGATATTGTG. According to the invention, the pair of specific primers is designed in a highly conserved domain in accordance with musk mitochondrion DNA (mtDNA) sequences revealed in GenBank; experimental results show that the primers are relatively good in specificity, specific amplification can be conducted on musk samples while cannot be conducted on other animal samples (including deer animals); and the primers are relatively high in sensitivity and are capable of detecting 102 copies / [micron]L according to the minimal order of plasmid copy magnitude. The method is applicable to rapid identification of common musk-derived ingredients on the market.

The invention relates to an insertional inactivation type cloning vector pAT 3733 with ampicillin and tetracycline resistant genes. The vector is obtained by the following steps: removing the Rop gene on pBR322 by double digestion method, filling in the end and looping internally. pAT3733 not only preserves the insertional inactivation screening mark of pBR322, but also has smaller molecular weight and higher stability, and the plasmid copy number increases more than three times, and the product is convenient for gene clone operation with higher operating efficiency. The product can replace pBR322 plasmid which is widely used at present, and is used as a general high efficiency cloning vector.

The present invention relates to a kind of promoter library, is used for expressing amylase BLA efficiently in Bacillus subtilis, and the probe carrier of described library is integrated type carrier, in order to avoid the impact of plasmid copy number on library characterization, on BLA expression frame There are strong transcription terminators in the downstream to avoid the influence of upstream and downstream genetic elements on the expression of BLA. The construction method of the library includes oligonucleotide annealing, type IIs restriction enzyme and ligase simultaneous digestion / enzyme ligation. In order to improve the integration efficiency of the probe carrier and reduce the background of the endogenous amylase AmyE, the CRISPR / cas9 system was used to introduce a DNA double-strand break at the integration site when the promoter library was transformed into Bacillus subtilis. After the transformation, it is spread on the substrate plate, and the transformants with large hydrolysis circles are re-screened through a 96-well plate, and the stronger transformants after re-screening are further re-screened through shake flasks. Through the above steps, 22 promoters that express BLA more efficiently than P43 were obtained, and the intensity of 7 hybrid promoters was higher than that of all original promoters.