31 results about "Plasmid copy number" patented technology

The invention discloses an absolute fluorescent quantitative polymerase chain reaction (PCR) primer pair, an absolute fluorescent quantitative PCR probe and an absolute fluorescent quantitative PCR method for determining the growth titer of mycoplasma hyopneumoniae. The sequences of the absolute fluorescent quantitative PCR primer pair are shown as SEQ ID NO.1 and SEQ ID NO.2. The sequence of the absolute fluorescent quantitative PCR probe is shown as SEQ ID NO.3. The absolute fluorescent quantitative PCR method for determining the growth titer of the mycoplasma hyopneumoniae comprises the following steps: (1) extracting the deoxyribose nucleic acid (DNA) of the mycoplasma hyopneumoniae; (2) performing common PCR amplification to obtain a target fragment, and designing the absolute fluorescent quantitative PCR primer pair and the absolute fluorescent quantitative PCR probe in the middle of the target fragment; (3) preparing plasmids by connecting the target fragment and a PMD-18-T carrier, transfecting competent cells, and extracting plasmids of a positive bacteria solution; (4) calculating an initial plasmid copy number by using the plasmids extracted in the step (3) as standard substances; and (5) performing fluorescent quantitative PCR. According to the absolute fluorescent quantitative PCR method for determining the growth titer of the mycoplasma hyopneumoniae, the copy number of target genes, namely the growth titer of the mycoplasma hyopneumoniae, can be quickly and accurately determined.

The invention provides a fluorescent quantitative PCR detection method for a TLR3 (toll-like receptors) gene of a duck. The detection method comprises the following steps: by taking a recombinant plasmid Peasy-T5-TLR3 as a template, screening the optimum concentration of a primer, a fluorescent quantitative PCR reaction system and a reaction condition; by taking the recombinant plasmid as a standard substance, determining the OD260 value; according to the molecular weight and the mass concentration, calculating the copy concentration, diluting, carrying out FQ-PCR amplification; by taking logarithm of the recombinant plasmid copy number as axis X and circulating number of times as axis Y, establishing a standard curve; repeatedly verifying 1.0*10<3>-1*10<8> copy/microliter recombinant plasmid; carrying out FQ-PCR detection on the recombinant plasmid; and carrying out double verification on the specificity of the detection method by virtue of sequence alignment of a sample and the standard substance and a peak pattern of a solubility curve of the sample.

The present invention describes a mutant plasmid replication control region having the ability to convey a phenotype of altered plasmid copy number to the plasmid on which it resides. The mutant replication control region is based on a similar region isolated from the pBBR1 plasmid family. Plasmids containing this replication control region cannot be classed as belonging to any known incompatibility group and thus may co-exist with a broad range of other plasmids in a single host.

The invention provides a culture medium for inducing plasmid copy number increase and an application thereof. The culture medium for inducing the plasmid copy number increase has the advantages that plasmid extraction concentration is improved by 45-95% in comparison with that of a traditional plasmid copy number induction method, and the plasmid extraction concentration is improved by 110-440% incomparison with that of a culture medium induction method free of glucose and arabinose. The culture medium plays very important roles in induction of the plasmid copy number increase and implementation of high throughput production.

Improvements in plasmid DNA production technology are needed to insure the economic feasibility of future DNA vaccines and DNA therapeutics. General methods are described, by means of which it is possible to dramatically increase plasmid DNA productivity. These processes feature RNA based inducers of plasmid copy number.

The invention discloses PCR detection primers and a detection method for musk-derived ingredients. The sequences of the primer pair are as shown in F-primer: TGGAGCTTTAACTAACTAGCCT, and R-primer: TGGATCAATGAGCGATATTGTG. According to the invention, the pair of specific primers is designed in a highly conserved domain in accordance with musk mitochondrion DNA (mtDNA) sequences revealed in GenBank; experimental results show that the primers are relatively good in specificity, specific amplification can be conducted on musk samples while cannot be conducted on other animal samples (including deer animals); and the primers are relatively high in sensitivity and are capable of detecting 102 copies/[micron]L according to the minimal order of plasmid copy magnitude. The method is applicable to rapid identification of common musk-derived ingredients on the market.

A nucleic acid molecule comprising a variant inc coding strand is disclosed as a regulator of plasmid copy number. Also disclosed is a replicon comprising the nucleic acid molecule, a promoter, and an origin of replication. Also disclosed is a vector comprising the replicon. Also disclosed is a recombinant microorganism comprising the vector.

Host vector system and methods for plasmid DNA and recombinant protein production. The system allows copy number control of a ColE1 plasmid in E. coli by an RNA molecule that is transcribed from the host's genome and that interacts with plasmid-transcribed RNAI or RNAII. The system can be extended to combine PCN control and antibiotic-free selection.

The invention belongs to the technical field of biology, and particularly relates to an expression plasmid with relatively high corynebacterium replication capacity. The nucleotide of the 1786th siteof the expression plasmid is A or G, and the rest sites are the same as the corresponding sites of plasmid pXMJ19; the nucleotide sequence of the expression plasmid is shown as SEQ ID NO: 13 or SEQ IDNO: 14. According to a construction method, a corynebacterium replicon regulating part of a pXMJ19 vector is used for carrying out artificial mutation on the nucleotide C at the 1786th site; two strains of corynebacterium/escherichia coli dual-purpose vectors pXMJ19C1786A and pXMJ19C1786G plasmids, of which the copy capability is 6-8.5 times higher than that of the pXMJ19 plasmids, are successfully obtained; wherein the copy number of the pXMJ19C1786A plasmid is about 115, and the copy number of the pXMJ19C1786G plasmid is about 170.

The invention relates to an insertional inactivation type cloning vector pATC 4185 with ampicillin and tetracycline resistant genes. The vector is obtained by the following steps: removing the Rop gene on pBR322 by double digestion method, filling in the end and looping internally. pATC4185 not only preserves the insertional inactivation screening mark of pBR322, but also has smaller molecular weight and higher stability, and the plasmid copy number increases more than three times, and the product is convenient for gene clone operation with higher operating efficiency. The product can replace pBR322 plasmid which is widely used at present, and is used as a general high efficiency cloning vector.

Provided herein are improved copy number plasmids, particularly those plasmids capable of replication in a bacterial cell. The improved copy number plasmid contain a deletion, insertion, or substitution in the replication control region, particularly a Pseudomonas-specific replication control region, that results in an increase in plasmid copy number in comparison to a control plasmid. Also provided are host cells containing the improved copy number plasmids, as well as methods of using the improved copy number plasmids for the recombinant production of a protein of interest. Further provided are methods for generating plasmids with improved copy number. The methods disclosed herein involve the reiterative selection of improved copy number plasmids by the growth and selection of plasmids capable of growth under increasing selective pressure, wherein the selective pressure is applied utilizing a selection agent to which the control plasmid confers resistance.

The invention provides a cold-shock expression T-vector and an application method thereof. Proteins coded by genes of animals, plants and normal temperature microbes are not stable, and most of the proteins are denaturated within a plurality of hours after heterogeneous expression; and proteins have inhibitory or poisoning effect on growth of recombinant cells, so recombinant expression is difficult to realize. The novel T-vector designed and constructed in the invention has the following characteristics: (1) the T-vector expresses an exogenous gene in a low temperature environment and can effectively prevent protein denaturation or reduce cytotoxicity; (2) the T-vector has mall plasmid molecular weight and the characteristics of great gene capacity, a high conversion rate, etc., and can improve gene cloning efficiency; (3) a plasmid copy number is high, so the level of expression is further increased; and (4) through combination with TA cloning technology and a low temperature expression function, the constructed T-vector is applicable to library construction and activity screening. As the vector provided by the invention is used for PCR cloning of coding genes of proteins with lability or cytotoxicity, construction and screening of a gene library and over-expression of the genes, operation steps can be simplified, materials and time can be saved, and the accuracy and success rate of testing can be improved.

The invention relates to a promoter library which is used for efficiently expressing amylase BLA in bacillus subtilis. A probe vector of the library is an integrated vector to avoid influence of plasmid copy number on library characterization; a strong transcription terminator is arranged on each of upstream and downstream of a BLA expression frame to avoid influence of upstream and downstream genetic elements on BLA expression. A building method of the library includes: oligonucleotide annealing and simultaneous enzyme digestion and enzyme linking of IIs-type restriction enzyme and ligase. Inorder to improve integration efficiency of the probe vector and lowering background of endogenous amylase AmyE, when the promoter library converts bacillus subtilis, a CRISPR/cas9 system is used to introduce DNA double-strand break at an integration site. After conversion, the promoter library is coated on a substrate flat plate, converters with large hydrolysis circles are re-screened through a96-well plate, and strong converters after re-screening are further re-screened through a shake flask. Through the above steps, 22 promoters with higher BLA expression efficiency than P43, in which 7hybrid promoters are higher than all starting promoters in strength.

The invention provides a combination of multiple primer pairs. The combination comprises a primer pair 5 and any one, two, three or four selected from primer pairs 1, 2, 3 and 4. The invention also provides a probe, a probe combination and a kit containing the primer pair combination and/or the probe or the probe combination. The invention also provides a method for determining a copy number of CAR plasmid and a method for controlling the residue of the CAR plasmid. The primer pair combination, the probe or the probe combination or the kit provided by the invention is simple and convenient tooperate, is good in specificity, high in sensitivity, high in reaction efficiency and good in reaction system repeatability, and can be used for quantitative detection of the copy number of the CAR plasmid containing the kana resistance gene or quantitative detection of the residual level of the CAR plasmid containing the kana resistance gene in peripheral blood of a patient treated by CAR-T celltransfusion.

The invention relates to an insertional inactivation type cloning vector pAT 3733 with ampicillin and tetracycline resistant genes. The vector is obtained by the following steps: removing the Rop gene on pBR322 by double digestion method, filling in the end and looping internally. pAT3733 not only preserves the insertional inactivation screening mark of pBR322, but also has smaller molecular weight and higher stability, and the plasmid copy number increases more than three times, and the product is convenient for gene clone operation with higher operating efficiency. The product can replace pBR322 plasmid which is widely used at present, and is used as a general high efficiency cloning vector.