Promoter library and strong promoter for amylase bla
A promoter and amylase technology, applied in the field of bioengineering, can solve the problems of difficulty in ensuring the expression amount, disproportionate intensity, low gene expression amount, etc., and achieve the effects of avoiding interference, improving efficiency, and expressing amylase BLA efficiently.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Embodiment 1 constructs promoter probe carrier
[0040] The integrative vector pDG1730 is a commonly used vector in this field. For related information, please refer to the literature Guérout-Fleury AM, Frandsen N, Stragier P. Plasmids for ectopic integration in Bacillus subtilis. Gene, 1996, 180(1): P.57-61. The integrative vector pDGT used in this example was constructed by the applicant, see patent CN 105296486A. The accession number of Bacillus licheniformis amylase BLA in NCBI is WP_003179447.1. The BLA was cloned into the pDGT vector to obtain the probe vector pDGT-BLA.
[0041] The specific method is as follows: using the Bacillus licheniformis genome as a template, amplify by primer pair (bla-F1: Cgggatccgagacgatgaaacaacaaaaacggctttacg and bla-R1: CCCAAGCTTCTATCTTGAACATAAATTGAAACCGACC), PCR reaction system: 10×Pfu buffer, 5 μl; dNTP (2.5mM), 2 μl; Forward primer (10 μM), 2 μl; reverse primer (10 μM), 2 μl; Pfu polymerase, 2 μl; template, 1 μl; add ddH 2 0 to ...
Embodiment 2
[0042] The construction of embodiment 2 promoter library
[0043] For a schematic illustration of the promoter library construction strategy see Figure 4 . Select six relatively strong promoters Pveg1, Pveg2, Pn26, PlepA, PtrnQ and PserA that have been reported as starting promoters (SEQ ID 1-6), because prokaryotic promoters have conserved -35 regions and -10 regions , with the -35 region and the -10 region as nodes, each promoter is divided into three regions, the upper, middle and lower reaches, and a pair of complementary phosphorylated oligonucleotide primers are designed for each region, that is, 6 primers are designed for each promoter sequence , a total of 36 phosphorylated oligonucleotide sequences (SEQ ID 7-42), after the complementary primers are annealed, the same region of different promoters has the same cohesive ends (ttg and tawwt), which can be randomly combined with each other to generate Promoter combinatorial library. Different promoters use the same RB...
Embodiment 3
[0048] Embodiment 3 Construction of CRISPR / cas9 system
[0049] Construct the Cas9 protein expression vector pHT01-cas9 and the sgRNA expression vector pHY300PLK-P242-AmyE-sgRNA (respectively refer to figure 2 and image 3 ).
[0050] 1) For cas9 gene DNA Polymerase was used for PCR, and the template was to clone the Cas9 gene into the pHT01 vector to obtain pHT01-cas9. The primers for amplifying cas9 are: cas9-F: CGCGGATCCATGGACAAGAAGTACAGCATCGGCCTGGCCA, cas9-R: gctctagaTCCTGATGAGCCTGAGCCGTGGTGGTGGTGGTGGTGGTC, PCR reaction system: 2×PrimeSTAR Mix, 25μl; forward primer (10mM), 2.5μl; reverse primer (10mM); 2.5μl Template, 0.5 μl; add ddH 2 0 to 50 μl. The amplification conditions are: 98°C, 10s; 55°C, 5s; 72°C, 20s; 28x; 72°C, 5min; 4°C, ∞. The cas9 fragment and the pHT01 vector were digested with Xba I and BamH I. The digestion system is: XbaⅠ, 0.5μl; BamHI, 1.5μl; 10×buffer, 5μl; PCR recovered product, 30μl. After being treated at 37°C for 2 hours, it was recovered...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com