Promoter library and strong promoter for amylase BLA

A strong promoter and promoter technology, applied in the field of bioengineering, can solve the problems of difficulty in ensuring the expression amount, disproportionate intensity, low gene expression amount, etc., to avoid interference, improve efficiency, and express amylase BLA efficiently.

Active Publication Date: 2018-02-16
QINGDAO VLAND BIOTECH GRP
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The applicant constructed a promoter library using GFP as a reporter gene in the previous research. However, when we used the screened promoter to express the target gene, the expression level of the gene was very low, and the expression level was not proportional to the strength of the promoter, suggesting that The promoter has a certain gene specificity, that is, when the strong promoter screened with the A gene as the reporter gene is used to express the B gene, it is often difficult to ensure efficient expression

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Promoter library and strong promoter for amylase BLA
  • Promoter library and strong promoter for amylase BLA
  • Promoter library and strong promoter for amylase BLA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Embodiment 1 constructs promoter probe carrier

[0040] The integrative vector pDG1730 is a commonly used vector in this field. For related information, please refer to the literature Guérout-Fleury AM, Frandsen N, Stragier P. Plasmids for ectopic integration in Bacillus subtilis. Gene, 1996, 180(1): P.57-61. The integrative vector pDGT used in this example was constructed by the applicant, see patent CN 105296486A. The accession number of Bacillus licheniformis amylase BLA in NCBI is WP_003179447.1. The BLA was cloned into the pDGT vector to obtain the probe vector pDGT-BLA.

[0041] The specific method is as follows: using the Bacillus licheniformis genome as a template, amplify by primer pair (bla-F1: Cgggatccgagacgatgaaacaacaaaaacggctttacg and bla-R1: CCCAAGCTTCTATCTTGAACATAAATTGAAACCGACC), PCR reaction system: 10×Pfu buffer, 5 μl; dNTP (2.5mM), 2 μl; Forward primer (10 μM), 2 μl; reverse primer (10 μM), 2 μl; Pfu polymerase, 2 μl; template, 1 μl; add ddH 2 0 to ...

Embodiment 2

[0042] The construction of embodiment 2 promoter library

[0043] For a schematic illustration of the promoter library construction strategy see Figure 4 . Select six relatively strong promoters Pveg1, Pveg2, Pn26, PlepA, PtrnQ and PserA that have been reported as starting promoters (SEQ ID 1-6), because prokaryotic promoters have conserved -35 regions and -10 regions , with the -35 region and the -10 region as nodes, each promoter is divided into three regions, the upper, middle and lower reaches, and a pair of complementary phosphorylated oligonucleotide primers are designed for each region, that is, 6 primers are designed for each promoter sequence , a total of 36 phosphorylated oligonucleotide sequences (SEQ ID 7-42), after the complementary primers are annealed, the same region of different promoters has the same cohesive ends (ttg and tawwt), which can be randomly combined with each other to generate Promoter combinatorial library. Different promoters use the same RB...

Embodiment 3

[0048] Embodiment 3 Construction of CRISPR / cas9 system

[0049] Construct the Cas9 protein expression vector pHT01-cas9 and the sgRNA expression vector pHY300PLK-P242-AmyE-sgRNA (respectively refer to figure 2 and image 3 ).

[0050] 1) For cas9 gene DNA Polymerase was used for PCR, and the template was to clone the Cas9 gene into the pHT01 vector to obtain pHT01-cas9. The primers for amplifying cas9 are: cas9-F: CGCGGATCCATGGACAAGAAGTACAGCATCGGCCTGGCCA, cas9-R: gctctagaTCCTGATGAGCCTGAGCCGTGGTGGTGGTGGTGGTGGTC, PCR reaction system: 2×PrimeSTAR Mix, 25μl; forward primer (10mM), 2.5μl; reverse primer (10mM); 2.5μl Template, 0.5 μl; add ddH 2 0 to 50 μl. The amplification conditions are: 98°C, 10s; 55°C, 5s; 72°C, 20s; 28x; 72°C, 5min; 4°C, ∞. The cas9 fragment and the pHT01 vector were digested with Xba I and BamH I. The digestion system is: XbaⅠ, 0.5μl; BamHI, 1.5μl; 10×buffer, 5μl; PCR recovered product, 30μl. After being treated at 37°C for 2 hours, it was recovered...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a promoter library which is used for efficiently expressing amylase BLA in bacillus subtilis. A probe vector of the library is an integrated vector to avoid influence of plasmid copy number on library characterization; a strong transcription terminator is arranged on each of upstream and downstream of a BLA expression frame to avoid influence of upstream and downstream genetic elements on BLA expression. A building method of the library includes: oligonucleotide annealing and simultaneous enzyme digestion and enzyme linking of IIs-type restriction enzyme and ligase. Inorder to improve integration efficiency of the probe vector and lowering background of endogenous amylase AmyE, when the promoter library converts bacillus subtilis, a CRISPR / cas9 system is used to introduce DNA double-strand break at an integration site. After conversion, the promoter library is coated on a substrate flat plate, converters with large hydrolysis circles are re-screened through a96-well plate, and strong converters after re-screening are further re-screened through a shake flask. Through the above steps, 22 promoters with higher BLA expression efficiency than P43, in which 7hybrid promoters are higher than all starting promoters in strength.

Description

technical field [0001] The invention relates to the field of bioengineering, in particular to a promoter library for a target gene, its construction method and the obtained strong promoter. Background technique [0002] α-amylase is one of the earliest, most widely used and most demanded industrial enzyme preparations, and occupies an important position in the domestic and foreign enzyme preparation markets. The α-amylase BLA derived from Bacillus lincheniformis is a high-temperature resistant amylase with an optimum temperature of about 90°C. It is used in starch liquefaction and other industries, as well as textile desizing and washing industries. [0003] Bacillus subtilis is a Gram-positive, rod-shaped soil bacterium. Bacillus subtilis has a strong secretion ability and can directly secrete foreign proteins into the medium, which not only effectively avoids the formation of inclusion bodies of proteins, but also greatly simplifies subsequent purification steps and reduc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/10C12N15/113C12N15/75C40B40/06C40B50/06C12N9/28
CPCC12N9/2417C12N15/1093C12N15/113C12N15/75C12Y302/01001C40B40/06C40B50/06
Inventor张桂敏卢争辉沈盼盼周玉玲马延和
OwnerQINGDAO VLAND BIOTECH GRP