Check patentability & draft patents in minutes with Patsnap Eureka AI!

Application of novel long-chain non-coding RNA-TreRNA1 related to human hepatocellular carcinoma

A human hepatocellular carcinoma, long-chain technology, applied in the field of molecular biology, can solve the problem of no specific research on the mechanism of action of hepatocellular carcinoma, and achieve the effect of inhibiting proliferation

Inactive Publication Date: 2020-04-28
QIANFOSHAN HOSPITAL OF SHANDONG
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, its mechanism of action in hepatocellular carcinoma has not been specifically studied

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of novel long-chain non-coding RNA-TreRNA1 related to human hepatocellular carcinoma
  • Application of novel long-chain non-coding RNA-TreRNA1 related to human hepatocellular carcinoma
  • Application of novel long-chain non-coding RNA-TreRNA1 related to human hepatocellular carcinoma

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1: Tissue chip in situ hybridization experiment to detect the expression of TreRNA1 at the tissue level 1. Experimental steps

[0031] (1) Design and synthesize a specific in situ hybridization probe (LNA) for TreRNA1 TM -enhanced detectionprobes), and separated and purified by high performance liquid chromatography (High Performance Liquid Chromatography, HPLC) after synthesis. The probe sequence is: 5'DigN ACTCTCTCAAAATCGGCCACGTA 3'DigN.

[0032] (2) The RNA in situ hybridization experiment was performed on the liver cancer tissue chip (chip number HLiv-HCC180Sur-05) using the synthesized specific in situ hybridization probe. Specific process:

[0033] 1) Deparaffinize the sample, remove xylene, digest the sample with protease, dehydrate the sample with alcohol, add 100ul of probe hybridization solution for hybridization, wash the slides strictly with SSC solution, and block in the blocking solution (1ml blocking solution: add 100ul 10X Roche blocking soluti...

Embodiment 2

[0039] Example 2: PT-PCR technology detects the expression of TreRNA1 at the cellular level

[0040] 1. Experimental steps

[0041] (1) Total RNA extraction from cultured cells

[0042] The column type total RNA extraction kit is used for the extraction of total cell RNA. The bottom of the spin column is a silicon substrate. During the extraction process, the principle of "high salt and low pH binding nucleic acid, low salt and high pH elution" of the silicon substrate is used to achieve the extraction and purification of total RNA. . The concentration and purity of the extracted total RNA were detected by ultra-micro-volume ultraviolet spectrophotometer.

[0043] (2) Reverse transcription reaction

[0044] 1) Reverse transcription reaction system

[0045]

[0046] 2) Reverse transcription reaction conditions

[0047] After adding the samples in order, gently pipette to mix and briefly centrifuge, and then set the reaction conditions according to the following procedur...

Embodiment 3

[0063] Example 3: Construction and verification of a HepG2 stable strain stably overexpressing TreRNA1

[0064] After cloning the target gene and the red fluorescent protein gene into the site-directed integration vector (using the target gene and fluorescent protein double reading frame plasmid), the targeted oligo and the site-directed integration vector are electroporated to the target cells at the same time, and then the site-directed integration vector is paired with G418 The pool cells after electroporation were killed by drugs, and single clones were screened out by the limiting dilution method. After expanding the culture, the positive clones were screened and verified by RT-PCR.

[0065] HepG2 stable strains and negative control stable strains that stably overexpress TRERNA1 have been successfully constructed and screened, such as image 3 As shown in A, the verification of the construction efficiency of the TreRNA1 overexpressed HepG2 stable strain. Among them, TreR...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of novel long-chain non-coding RNA-TreRNA1 related to human hepatocellular carcinoma. According to the invention, firstly, screening is performed to obtain a novel long-chain non-coding RNA-TreRNA1 with high expression in hepatocellular carcinoma; and then, an inhibitor for inhibiting expression of RNA-TreRNA1 is screened out by taking the long-chain non-coding RNA-TreRNA1 as a target. After expression of the RNA-TreRNA1 is inhibited, proliferation, invasion and migration capability of hepatocellular carcinoma cells can be inhibited, so that the long-chain non-coding RNA-TreRNA1 can be used as a gene target for preventing or treating hepatocellular carcinoma to screen preparations for preventing or treating hepatocellular carcinoma. Moreover, the preparation for inhibiting expression of the long-chain non-coding RNA-TreRNA1 also provides a new idea and a solution for prevention and treatment of the hepatocellular carcinoma.

Description

technical field [0001] The invention relates to the application of long-chain non-coding RNA-TreRNA1 related to human hepatocellular carcinoma, belonging to the field of molecular biology. Background technique [0002] Hepatocellular carcinoma is a malignant tumor with high morbidity and mortality, and is the third leading risk factor for tumor-related death, with more than 700,000 new cases each year. The early symptoms and signs of liver cancer are relatively hidden, and the diagnosis rate is low. By the time of clinical diagnosis, the course of the disease has mostly developed to the middle and late stage, and most patients have missed the best time for surgery. At the same time, the prognosis of liver cancer patients is poor, and metastasis and recurrence are common. . Therefore, it is imminent to study the pathogenesis of HCC, discover biomarkers for early diagnosis and prognosis of HCC, and explore new therapeutic targets. [0003] Long non-coding RNAs (lncRNAs), a c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886C12N15/113A61K31/7105A61P35/00
CPCC12Q1/6886C12N15/113A61K31/7105A61P35/00C12Q2600/178
Inventor 曹莉莉李红磊赵传喜朱婷婷胡辛柴小雪叶辉吕欣然丁绪超张明洋孔歉歉
Owner QIANFOSHAN HOSPITAL OF SHANDONG
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com