Ornithogalum thyrsoides dwarf multi-tiller OtDWARF53 gene and application thereof
A technology of evergreen and tiger eye, applied in dwarf multi-tiller OtDWARF53 gene and application field of evergreen evergreen
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Example 1 Preparation Ot DWARF53 Gene:
[0043] The leaves of the aseptic tissue-cultured plantlets of Dieffenbachia tiger-eye were cut on a sterilized ultra-clean workbench and transferred to the medium containing cytokinin. After 20 to 30 days, multiple green leaves gradually grew on the surface of the leaves. The bulbils on the leaves began to form. Using the bulbils on the leaves of Diphtheria punctatus as material, RNA was extracted and reverse-transcribed into cDNA. The corresponding primers were designed for PCR. After agarose gel electrophoresis, the target band was recovered and compared with The pMD19-T vector was ligated, transformed into Escherichia coli, sequenced and analyzed. Pick positive clones for plasmid extraction, design two seamlessly fused primers according to the sequence information of the pHB plant expression vector, and use high-fidelity enzymes for PCR amplification of the positive plasmid, and perform linearization with the pHB plant expre...
Embodiment 2
[0060] Example 2 Gene function verification
[0061] First build evergreen OtDWARF53 Transgenic plant expression vector, transformed into wild-type tobacco, for eukaryotic cell expression and phenotype observation, identification and analysis of transgenic tobacco plants
[0062] (one) OtDWARF53 Construction of constitutive plant expression vectors for genes
[0063] 1. Will OtDWARF53 The ORF of the gene is cloned into the pHB vector and placed under the control of the ubiquitin promoter;
[0064] Use HindIII and BamHI to double digest and purify the pHB plant expression vector to make it linear
[0065] 2. According to the above-mentioned evergreen OtDWARF53 The cDNA sequence of the gene and the 15-20 bases next to the HindIII and BamHI restriction sites of the pHBYFP vector are used to design seamless primers. The sequence is as follows:
[0066] Hind III OtDWARF53F :accactctctgtctc AAGCTT ATGCCGACACCGGTCAGTAGC, its nucleotide sequence is shown in SEO ID NO.5; the ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com