Supercharge Your Innovation With Domain-Expert AI Agents!

Ornithogalum thyrsoides dwarf multi-tiller OtDWARF53 gene and application thereof

A technology of evergreen and tiger eye, applied in dwarf multi-tiller OtDWARF53 gene and application field of evergreen evergreen

Inactive Publication Date: 2020-05-08
SICHUAN TIANYI ECOLOGICAL GARDEN GRP CO LTD +2
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0013] This shows that the DWARF53 gene has important value and significance for scientific research and production, but it is only limited to a very small number of crops such as rice, and it is rarely reported in horticultural plants;

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Ornithogalum thyrsoides dwarf multi-tiller OtDWARF53 gene and application thereof
  • Ornithogalum thyrsoides dwarf multi-tiller OtDWARF53 gene and application thereof
  • Ornithogalum thyrsoides dwarf multi-tiller OtDWARF53 gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1 Preparation Ot DWARF53 Gene:

[0043] The leaves of the aseptic tissue-cultured plantlets of Dieffenbachia tiger-eye were cut on a sterilized ultra-clean workbench and transferred to the medium containing cytokinin. After 20 to 30 days, multiple green leaves gradually grew on the surface of the leaves. The bulbils on the leaves began to form. Using the bulbils on the leaves of Diphtheria punctatus as material, RNA was extracted and reverse-transcribed into cDNA. The corresponding primers were designed for PCR. After agarose gel electrophoresis, the target band was recovered and compared with The pMD19-T vector was ligated, transformed into Escherichia coli, sequenced and analyzed. Pick positive clones for plasmid extraction, design two seamlessly fused primers according to the sequence information of the pHB plant expression vector, and use high-fidelity enzymes for PCR amplification of the positive plasmid, and perform linearization with the pHB plant expre...

Embodiment 2

[0060] Example 2 Gene function verification

[0061] First build evergreen OtDWARF53 Transgenic plant expression vector, transformed into wild-type tobacco, for eukaryotic cell expression and phenotype observation, identification and analysis of transgenic tobacco plants

[0062] (one) OtDWARF53 Construction of constitutive plant expression vectors for genes

[0063] 1. Will OtDWARF53 The ORF of the gene is cloned into the pHB vector and placed under the control of the ubiquitin promoter;

[0064] Use HindIII and BamHI to double digest and purify the pHB plant expression vector to make it linear

[0065] 2. According to the above-mentioned evergreen OtDWARF53 The cDNA sequence of the gene and the 15-20 bases next to the HindIII and BamHI restriction sites of the pHBYFP vector are used to design seamless primers. The sequence is as follows:

[0066] Hind III OtDWARF53F :accactctctgtctc AAGCTT ATGCCGACACCGGTCAGTAGC, its nucleotide sequence is shown in SEO ID NO.5; the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of plant genetic engineering, and in particular relates to an ornithogalum thyrsoides dwarf multi-tiller OtDWARF53 gene and an application thereof. The nucleotide sequence of the gene is shown in SEO ID NO.1, and the amino acid sequence of a protein encoded by the gene is shown in SEO ID NO.2. The key gene DWARF53 (DWF53) for regulating strigolactones is isolated from ornithogalum thyrsoides based on the obtained invention patent of induction and tissue culture of foliar bulbiets of the ornithogalum thyrsoides and based on ornithogalum thyrsoides tertiary and secondary generation transcriptome conjoint analysis results (3+2), and a constitutive plant expression vector pHB+ OtDWARF53 is constructed, the pHB+ OtDWARF53 is transferred into tobacco,results find that transgenic tobacco plants show the following phenotys: plants have dwarf phenomena, multiple shoots are generated at stem tips, axillary bud lateral buds are formed at leaf axils, and the appearance is more plump, and the results indicate that the gene can have the functions of making the plants dwarf and promoting multi-tiller and multi-branch; and the invention specifically relates to the application of the gene in plant type regulation of regulating plant heights and promoting the development of the axillary bud lateral buds.

Description

technical field [0001] The invention relates to the technical field of plant genetic engineering, in particular to a dwarfing and multi-tillering Divinia chinensis OtDWARF53 Genes and applications. Background technique [0002] Plant type formation in higher plants refers to the occurrence of plant shape-related organs throughout the growth and development of plants, especially the formation, shape and placement of branches, leaves and flower organs. The formation process of plant type is mainly regulated by internal factors such as genetics and plant hormones, and is also affected by external environmental factors such as photoperiod, temperature, water and fertilizer. The molecular mechanism of plant type formation in higher plants is a basic scientific issue in the study of plant growth and development, and is of great value and significance for both scientific research and production. [0003] In crops, plant type directly affects plant tillering, as well as the number...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/82C12N15/10C07K14/415A01H5/00A01H6/56
CPCC07K14/415C12N15/8261
Inventor 姜福星黄远祥周鹏何伟李西孙大江
Owner SICHUAN TIANYI ECOLOGICAL GARDEN GRP CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More