Novel application of pig GADD45a gene and construction and application of high-expression cell line
A high-expression, cell-line technology, applied in genetically modified cells, epidermal cells/skin cells, cells modified by introducing foreign genetic material, etc., can solve the problems of few research reports on porcine GADD45a.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0040] The present invention will be further elaborated below in conjunction with the accompanying drawings and embodiments.
[0041] (1) Construction and identification of porcine GADD45a gene lentiviral expression vector
[0042] 1. Design of full-length primers for porcine GADD45a gene
[0043] Primers for amplifying the 499bp sequence were designed using oligo 6.0 primer software. In order to facilitate cloning with the pLEX-MCS vector, Xho I and BamH I restriction sites were added to both ends of the primers. The primer sequences are as follows:
[0044] GADD45a-F: 5'-GAG GATCC ACTAGT ATG ACTTTGGAGGAATTCTCGGCT -3’ (Italics are Bam H I restriction site, the underline is the start codon);
[0045] GADD45a-R: 5’-CGA GCGGCCGC TCAAGCGTAGTCTGGGACGGTATGGGTA CCGTCCGTTCAGGAAGA-3' (Italics are Not I restriction sites, double underlines are stop codons, and underlines are HA tag sequences).
[0046] 2. Extraction of total RNA
[0047] The piglets were taken out one w...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



