Identification and application of fatty acid transporter gene BnFAX6 for brassica napus
A Brassica napus, transporter technology, applied in application, genetic engineering, plant genetic improvement and other directions, can solve the problems of increasing oil accumulation in seeds, unclear influence of rape plant type, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0043] Cloning identification and functional analysis of the full-length sequence of a Brassica napus fatty acid transport gene BnFAX6:
[0044] 1. Isolation and identification of BnFAX6 gene
[0045] We used the reported Arabidopsis fatty acid transport genes AtFAX1 (AT3G57280.1) and AtFAX6 (AT3G20510.1) in the Brassica napus genome database to obtain 12 fatty acid transport related genes through bioinformatics analysis and screening (Blast). The expression profiles of these genes were analyzed, and it was found that the gene numbered BnaCnng46150D (named BnFAX6) was predominantly expressed in rapeseed. According to the information provided in the Brassica napus genome database, primers (BnFAX6Up: ATGCATGATTTCTGCTTCACAATAC, BnFAX6Down: TCATTCAGCTTTTGATGGG) were designed, and the total DNA of rapeseed leaves was used as a template to amplify the full-length DNA sequence and coding region sequence of the gene by PCR technology. The full-length DNA sequence is shown in SEQ ID N...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com