Identification and application of fatty acid transporter gene BnFAX6 for brassica napus

A Brassica napus, transporter technology, applied in application, genetic engineering, plant genetic improvement and other directions, can solve the problems of increasing oil accumulation in seeds, unclear influence of rape plant type, etc.

Pending Publication Date: 2020-05-29
HUAZHONG NORMAL UNIV
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although it has been reported in Arabidopsis that FAX1 increases the transport rate of fatty acids synthesized in chloroplasts, thereby increasing the accumulation of oil in seeds, the function of this protein in rapeseed and its effect on rapeseed plant architecture are still unknown. don't know

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Identification and application of fatty acid transporter gene BnFAX6 for brassica napus
  • Identification and application of fatty acid transporter gene BnFAX6 for brassica napus
  • Identification and application of fatty acid transporter gene BnFAX6 for brassica napus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0043] Cloning identification and functional analysis of the full-length sequence of a Brassica napus fatty acid transport gene BnFAX6:

[0044] 1. Isolation and identification of BnFAX6 gene

[0045] We used the reported Arabidopsis fatty acid transport genes AtFAX1 (AT3G57280.1) and AtFAX6 (AT3G20510.1) in the Brassica napus genome database to obtain 12 fatty acid transport related genes through bioinformatics analysis and screening (Blast). The expression profiles of these genes were analyzed, and it was found that the gene numbered BnaCnng46150D (named BnFAX6) was predominantly expressed in rapeseed. According to the information provided in the Brassica napus genome database, primers (BnFAX6Up: ATGCATGATTTCTGCTTCACAATAC, BnFAX6Down: TCATTCAGCTTTTGATGGG) were designed, and the total DNA of rapeseed leaves was used as a template to amplify the full-length DNA sequence and coding region sequence of the gene by PCR technology. The full-length DNA sequence is shown in SEQ ID N...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to identification and application of a fatty acid transporter gene BnFAX6 sequence for brassica napus, and relates to a chloroplast fatty acid transporter gene capable of increasing the yield of brassica napus and the oil content of brassica napus seeds. The BnFAX6 gene comprises 3 exons and 2 introns, and protein containing 119 amino acids is encoded. The BnFAX6 gene is predominantly expressed in the brassica napus seeds in a key period of oil synthesis. Compared with a wild type, the gene provided by the invention has the advantages that the oil content of the transgenic brassica napus seeds with the overexpression of BnFAX6 is obviously improved, which indicates that BnFAX6 plays an important role in the oil synthesis process of the brassica napus seeds. Compared with the wild type, the 35S promoter-driven transgenic brassica napus with overexpression of BnFAX6 also shows phenotypes that the plant height is reduced, lateral branches are increased, and the yieldis greatly improved. In conclusion, the invention provides the functional gene with an important application value in high-yield and high-oil-content breeding of brassica napus.

Description

Technical field: [0001] The invention relates to the cloning and functional identification of a fatty acid transporter gene BnFAX6 which can not only increase the yield of rapeseed but also increase the oil content of seeds. Background technique: [0002] Rapeseed is one of the four major oil crops in my country. Rapeseed oil is not only the main source of edible oil, but also an important raw material crop to solve the global energy shortage. With the increase of world population, people's demand for edible oil and biodiesel is increasing day by day. Rapeseed oil is the largest source of edible vegetable oil in my country. Although my country's rapeseed planting area and total output account for about 30% of the world, due to the large population, the annual rapeseed import volume is still huge. Therefore, improving rapeseed yield and seed oil content has always been the research direction and breeding goal of rapeseed industry development. [0003] The number of branche...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/00A01H6/20
CPCC07K14/415C12N15/8247C12N15/8261
Inventor李学宝黄克林田婧
OwnerHUAZHONG NORMAL UNIV