Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant antibody against human pepsinogen II

A pepsinogen and antigen technology, applied in the field of immunity, can solve the problems of low activity and poor affinity, and achieve the effect of high affinity and strong binding protein activity

Active Publication Date: 2020-06-02
DONGGUAN PENGZHI BIOTECH CO LTD
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The clinical methods used to detect the level of PG II include enzyme-linked immunosorbent assay (ELISA), chemiluminescence, flow fluorescence luminescence, time-resolved fluorescence immunoassay, photochemiluminescence immunoassay, colloidal gold, etc., different methods Each has its own advantages and disadvantages, but all require specific monoclonal antibodies against PGII
[0005] Existing anti-human PGII antibodies cannot be well applied to the detection of PGII protein due to their low activity and poor affinity. Therefore, there is a strong demand in the field for antibodies that effectively and specifically bind to and detect PGII

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant antibody against human pepsinogen II
  • Recombinant antibody against human pepsinogen II
  • Recombinant antibody against human pepsinogen II

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0122] This example provides an exemplary preparation method of a recombinant antibody against human pepsinogen II.

[0123] S10, construction of expression plasmids:

[0124] In this embodiment, restriction endonuclease and Prime Star DNA polymerase were purchased from Takara Company;

[0125] MagExtractor-RNA extraction kit was purchased from TOYOBO;

[0126] BD SMART TM RACE cDNA Amplification Kit was purchased from Takara;

[0127] The pMD-18T vector was purchased from Takara;

[0128] The plasmid extraction kit was purchased from Tiangen Company;

[0129] Primer synthesis and gene sequencing were completed by Invitrogen;

[0130] The secreted Anti-HPG II 11C2 monoclonal antibody is an existing hybridoma cell line, and it is recovered for later use.

[0131] S11, design and synthesis of primers:

[0132] 5' RACE upstream primers for amplification of heavy and light chains:

[0133] SMARTER II A Oligonucleotide:

[0134] 5'>AAGCAGTGGTATCAACGCAGAGGTACXXXXX<3';

[...

Embodiment 2

[0154] Transient Transfection of Recombinant Antibody Expression Plasmids into CHO Cells and Identification of Antibody Activity in Expression Supernatant

[0155] The plasmid was diluted to 400ng / ml with ultrapure water, and the CHO cells were adjusted to 1.43×10 7 cells / ml in a centrifuge tube, mix 100ul plasmid with 700ul cells, transfer to an electroporation cup, electroporation, take samples and count on the 3rd, 5th, and 7th day, and collect the sample on the 7th day for detection. The electrophoresis of the obtained antibody is as follows figure 1 As shown, two bands were shown after reducing SDS-PAGE, one with a Mr of 50KD (heavy chain) and the other with a Mr of 28KD (light chain). (light and heavy chains having sequences as shown in SEQ ID NO: 11 and 12).

[0156] After analysis, the complementarity determining region (WT) of the heavy chain:

[0157] CDR-VH1 is G-Y-S(X1)-F-T-Q(X2)-H-G(X3)-M-N;

[0158] CDR-VH2 is I-N-S(X1)-F-T-A(X2)-Q-P-T-F(X3)-A-D-D-F;

[0159]...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombinant antibody against human pepsinogen II (PG II), and studies preparation and application of the recombinant antibody. The binding protein has strong activity, has high affinity with human PG II protein, and can be widely used in the field of detection of the PG II protein.

Description

technical field [0001] The invention relates to the technical field of immunization, in particular to a recombinant antibody against human pepsinogen II. Background technique [0002] Pepsinogen (Pepsinogen, PG) is the precursor of pepsin in gastric juice. The protein molecule is about 43KD and consists of 300 amino acids. According to different biochemical and immunological characteristics, it can be divided into two subgroups, PGI (also known as PGA) and PG II (also known as PGC). Proteaseogen C (PGC) is derived from the whole gastric glands (gastric efferent glands, fundic glands, gastric antrum pyloric glands) and distal duodenal Brunner's glands, a small amount of PGC is also produced by the prostate and pancreas, and PGC synthesized by the gastric mucosa It is about 25% of the total amount. Most of the synthesized PG enters the gastric cavity and is activated into pepsin under the action of acidic gastric juice. Only a small amount (about 1%) of PG enters the blood ci...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/40C12N15/13C12N15/85C12N5/10G01N33/574G01N33/68
CPCC07K16/40C07K2317/565C07K2317/92G01N33/57446G01N33/6893G01N2800/062G01N2800/065
Inventor 孟媛钟冬梅黄玉玲游辉范凌云
Owner DONGGUAN PENGZHI BIOTECH CO LTD