Recombinant antibody against human pepsinogen II
A pepsinogen and antigen technology, applied in the field of immunity, can solve the problems of low activity and poor affinity, and achieve the effect of high affinity and strong binding protein activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0122] This example provides an exemplary preparation method of a recombinant antibody against human pepsinogen II.
[0123] S10, construction of expression plasmids:
[0124] In this embodiment, restriction endonuclease and Prime Star DNA polymerase were purchased from Takara Company;
[0125] MagExtractor-RNA extraction kit was purchased from TOYOBO;
[0126] BD SMART TM RACE cDNA Amplification Kit was purchased from Takara;
[0127] The pMD-18T vector was purchased from Takara;
[0128] The plasmid extraction kit was purchased from Tiangen Company;
[0129] Primer synthesis and gene sequencing were completed by Invitrogen;
[0130] The secreted Anti-HPG II 11C2 monoclonal antibody is an existing hybridoma cell line, and it is recovered for later use.
[0131] S11, design and synthesis of primers:
[0132] 5' RACE upstream primers for amplification of heavy and light chains:
[0133] SMARTER II A Oligonucleotide:
[0134] 5'>AAGCAGTGGTATCAACGCAGAGGTACXXXXX<3';
[...
Embodiment 2
[0154] Transient Transfection of Recombinant Antibody Expression Plasmids into CHO Cells and Identification of Antibody Activity in Expression Supernatant
[0155] The plasmid was diluted to 400ng / ml with ultrapure water, and the CHO cells were adjusted to 1.43×10 7 cells / ml in a centrifuge tube, mix 100ul plasmid with 700ul cells, transfer to an electroporation cup, electroporation, take samples and count on the 3rd, 5th, and 7th day, and collect the sample on the 7th day for detection. The electrophoresis of the obtained antibody is as follows figure 1 As shown, two bands were shown after reducing SDS-PAGE, one with a Mr of 50KD (heavy chain) and the other with a Mr of 28KD (light chain). (light and heavy chains having sequences as shown in SEQ ID NO: 11 and 12).
[0156] After analysis, the complementarity determining region (WT) of the heavy chain:
[0157] CDR-VH1 is G-Y-S(X1)-F-T-Q(X2)-H-G(X3)-M-N;
[0158] CDR-VH2 is I-N-S(X1)-F-T-A(X2)-Q-P-T-F(X3)-A-D-D-F;
[0159]...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap