Method for increasing muscle mass of pigs

A muscle mass and muscle tissue technology, applied in the application field of muscle mass and muscle fiber density, can solve the problems of difficulty, low efficiency, long time, etc., and achieve the effect of low cost, high overexpression and interference efficiency, and high safety.

Active Publication Date: 2020-06-02
HUAZHONG AGRI UNIV
View PDF8 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although transgenic technology and gene knockout technology can help to increase the speed of animal breeding, because transgenic technology and gene knockout technology can change the genomic DNA of organisms, there is a certain degree of safety and off-target rate, and these technologies are efficient. Disadvantages such as low and long time
At the same time, livestock products prepared by transgenic technology and gene knockout technology are prohibited from entering the market due to biosafety issues, and the public has a high resistance and fear of genetically modified organisms
Therefore, it is very difficult to use transgenic technology and gene knockout technology to improve and prepare livestock products with excellent traits.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for increasing muscle mass of pigs
  • Method for increasing muscle mass of pigs
  • Method for increasing muscle mass of pigs

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Example 1: Sequence analysis and expression of pig MN864465 gene

[0059] 1.1 Gene sequence of pig MN864465

[0060] The full-length sequence of pig MN864465 was amplified by 5' and 3' RACE assay ( figure 1 ), the sequence length is 1462nt.

[0061] The full-length sequence of the pig MN864465 gene:

[0062] GTGTTTAACATCCAGAGAATGGAAACTTACATACATGTGACCATCTATTCCATGTAACGGCCCTTCCTTTGATTTTATGGAGGCAATGGAGTTGGTCCTGTGTAAGCTCAAGCTAAAAATAAGCCCATGGGGATCAT AACATAAAGTAGGTGACACGTTTGGGTGTGTGGGAGGGGGAAAGCCTGGGAGAAAGGGAGAAGTCT TTTCCTCAGCCTTGTCTGGGGACAACCTTTCACTCCAACAGAGGGAGAGTAGGTTGACAGCAGCAGG AATTGTTTTTTGTGAAACTCAGGGCATTTGCTGTGCCAGCATCCAGGTGGTAATGTATGACACTGCTGT GGAGAAGTGGGCTCTGGCCCTTCCTTCTCATACGTAGGAGGGAATGGCAAGGACTGGAGACATTGCA GTTTTACCTCTTGAAGGTCTTACAGCTCTCCAGCTTTGTACACAGGAACCTCAATGCTCTTAACAGAG AGGCAGTCATGGAGACATAGGGAAAGAGTGGTTGACAGGGGCAGACGTGGATGGATTGTGAGCACA CCCATCCTCAGGAAGGCTGCCGCAGAAGGATGTGAGTGAGCTTGTCCCTGAGCGTGGAGGAGGAGCT AACAAGCTTCCAATTATTAGTGTTCCTGGGGCACTGTGATTATACTTATATCTGTGTG...

Embodiment 2

[0072] Example 2: The pig MN864465 gene can promote the proliferation of pig skeletal muscle satellite cells and inhibit the differentiation of skeletal muscle satellite cells

[0073] 2.1 Construction and packaging of pig MN864465 gene interference and overexpression lentiviral vector

[0074] According to the nucleotide sequence of the pig MN864465 gene, the siRNA design software (BLOCK-iT TM RNAiDesigner) designed the interference fragment of MN864465, constructed the MN864465 interference siRNA onto the lentiviral interference vector (pLKO.1), and used 293T cells (purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences) to package the MN864465 interference vector lentivirus. The MN864465 siRNA sequence is as follows:

[0075] siRNA-F: GGCAAGGACUGGAGACAUUTT,

[0076] siRNA-R: AAUGUCUCCAGUCCUUGCCTT.

[0077] MN864465 primers were designed according to the nucleotide sequence of MN864465 to amplify the full-length sequence, and the full-length sequence of ...

Embodiment 3

[0084] Embodiment 3: MN864465 can inhibit the growth and development of pig skeletal muscle

[0085] The MN864465 overexpression lentivirus was used to inject the left leg muscle of 15-day-old piglets, and the overexpression empty vector lentivirus was used as a control to inject the pig right leg muscle. 2 consecutive injections, 7 days apart each time. After the injection, the piglets were sacrificed, the gastrocnemius and biceps femoris were separated, and H&E staining was performed to detect the effect of overexpression of MN864465 on the cross-sectional area of ​​pig muscle fibers and the number of muscle fibers. The collected pictures were used Image J software to count the density of muscle fibers and the cross-sectional area of ​​muscle fibers. The results showed that the gastrocnemius and biceps femoris overexpressing MN864465 had significantly increased muscle fiber density and decreased muscle fiber cross-sectional area ( Figure 17-19 ). This indicates that over...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of screening and application of molecular markers of pigs and specifically relates to a method for increasing muscle mass of the pigs. The method disclosedby the invention increases the muscle mass and muscle fiber density of the pigs through interference and over-expression of an MN864465 gene. The MN864465 gene is obtained through amplification in agenome of large white pigs, wherein a nucleotide sequence of the gene is shown in SEQ ID NO:1, and the sequence is located in areas 104, 826, 111-104, 827 and 563 in a No.8 chromosome of the pigs. Twocarriers are obtained through construction, the gene is over-expressed and intervened in a porcine skeletal muscle satellite cell respectively, and the gene is found to promote proliferation of the porcine skeletal muscle satellite cell and restrain differentiation of the porcine skeletal muscle satellite cell, namely the muscle mass and muscle fiber density of the pigs can be increased. Growth and development of muscle can be restrained during lentivirus injection of leg muscle of the pigs and mice with over-expression of the gene. The method provided by the invention provides new resource for muscle improvement of the pigs.

Description

technical field [0001] The invention belongs to the technical field of screening and application of pig molecular markers, and in particular relates to an application of cultivating and improving the muscle mass and muscle fiber density of animals, especially pigs, by interfering and overexpressing the MN864465 gene. The ability to detect skeletal muscle cell proliferation and differentiation was reduced and overexpressed MN864465 by lentivirus-mediated interference and overexpression, respectively. Using lentivirus-mediated overexpression MN864465 vector to inject mouse and pig skeletal muscle, detect the effect on muscle growth and development, and provide a method and application for increasing animal muscle mass. Background technique [0002] Muscle is an important part of the animal body and plays an important role in humans and animals. The growth and development of muscle directly affects the life activities of human beings and the economic value of animals. Muscle ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12N15/113C12N15/867A01K67/027
CPCA01K67/0275A01K67/0278A01K2207/05A01K2207/15A01K2217/072A01K2227/108A01K2267/02C07K14/47C12N15/113C12N15/86C12N2310/14C12N2740/15043
Inventor左波靳建军徐在言张佳丽吕威
OwnerHUAZHONG AGRI UNIV