Method for increasing muscle mass of pigs
A muscle mass and muscle tissue technology, applied in the application field of muscle mass and muscle fiber density, can solve the problems of difficulty, low efficiency, long time, etc., and achieve the effect of low cost, high overexpression and interference efficiency, and high safety.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] Example 1: Sequence analysis and expression of pig MN864465 gene
[0059] 1.1 Gene sequence of pig MN864465
[0060] The full-length sequence of pig MN864465 was amplified by 5' and 3' RACE assay ( figure 1 ), the sequence length is 1462nt.
[0061] The full-length sequence of the pig MN864465 gene:
[0062] GTGTTTAACATCCAGAGAATGGAAACTTACATACATGTGACCATCTATTCCATGTAACGGCCCTTCCTTTGATTTTATGGAGGCAATGGAGTTGGTCCTGTGTAAGCTCAAGCTAAAAATAAGCCCATGGGGATCAT AACATAAAGTAGGTGACACGTTTGGGTGTGTGGGAGGGGGAAAGCCTGGGAGAAAGGGAGAAGTCT TTTCCTCAGCCTTGTCTGGGGACAACCTTTCACTCCAACAGAGGGAGAGTAGGTTGACAGCAGCAGG AATTGTTTTTTGTGAAACTCAGGGCATTTGCTGTGCCAGCATCCAGGTGGTAATGTATGACACTGCTGT GGAGAAGTGGGCTCTGGCCCTTCCTTCTCATACGTAGGAGGGAATGGCAAGGACTGGAGACATTGCA GTTTTACCTCTTGAAGGTCTTACAGCTCTCCAGCTTTGTACACAGGAACCTCAATGCTCTTAACAGAG AGGCAGTCATGGAGACATAGGGAAAGAGTGGTTGACAGGGGCAGACGTGGATGGATTGTGAGCACA CCCATCCTCAGGAAGGCTGCCGCAGAAGGATGTGAGTGAGCTTGTCCCTGAGCGTGGAGGAGGAGCT AACAAGCTTCCAATTATTAGTGTTCCTGGGGCACTGTGATTATACTTATATCTGTGTG...
Embodiment 2
[0072] Example 2: The pig MN864465 gene can promote the proliferation of pig skeletal muscle satellite cells and inhibit the differentiation of skeletal muscle satellite cells
[0073] 2.1 Construction and packaging of pig MN864465 gene interference and overexpression lentiviral vector
[0074] According to the nucleotide sequence of the pig MN864465 gene, the siRNA design software (BLOCK-iT TM RNAiDesigner) designed the interference fragment of MN864465, constructed the MN864465 interference siRNA onto the lentiviral interference vector (pLKO.1), and used 293T cells (purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences) to package the MN864465 interference vector lentivirus. The MN864465 siRNA sequence is as follows:
[0075] siRNA-F: GGCAAGGACUGGAGACAUUTT,
[0076] siRNA-R: AAUGUCUCCAGUCCUUGCCTT.
[0077] MN864465 primers were designed according to the nucleotide sequence of MN864465 to amplify the full-length sequence, and the full-length sequence of ...
Embodiment 3
[0084] Embodiment 3: MN864465 can inhibit the growth and development of pig skeletal muscle
[0085] The MN864465 overexpression lentivirus was used to inject the left leg muscle of 15-day-old piglets, and the overexpression empty vector lentivirus was used as a control to inject the pig right leg muscle. 2 consecutive injections, 7 days apart each time. After the injection, the piglets were sacrificed, the gastrocnemius and biceps femoris were separated, and H&E staining was performed to detect the effect of overexpression of MN864465 on the cross-sectional area of pig muscle fibers and the number of muscle fibers. The collected pictures were used Image J software to count the density of muscle fibers and the cross-sectional area of muscle fibers. The results showed that the gastrocnemius and biceps femoris overexpressing MN864465 had significantly increased muscle fiber density and decreased muscle fiber cross-sectional area ( Figure 17-19 ). This indicates that over...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap