Method for constructing luciferase high-expressed stable cell line and cell line

A technology of luciferase and construction method, which can be applied in the field of Huh7 cell line, and can solve problems such as difficulties in the treatment of liver cancer

Pending Publication Date: 2020-06-05
DALIAN INST OF CHEM PHYSICS CHINESE ACAD OF SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to its high metastatic potential, the treatment of liver cancer is difficult

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing luciferase high-expressed stable cell line and cell line
  • Method for constructing luciferase high-expressed stable cell line and cell line
  • Method for constructing luciferase high-expressed stable cell line and cell line

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0013] Example 1 pWPXLd-luciferase virus packaging and infection

[0014] The construction method of the pWPXLd-luciferase plasmid used refers to the master's thesis "Construction of MDA-MB-231 breast cancer cell line stably expressing luciferase and its activity characterization, Zhou Xin, Northeast Normal University".

[0015] 1. Day 1: Place 3x10 6 293T cells were planted in a 10cm dish, cultured in 10ml of DMEM medium supplemented with fetal bovine serum, this medium did not contain antibiotics, placed at 37°C, 5% CO 2 (CO 2 5% air by volume) in an incubator.

[0016] 2. The next day: when the coverage rate of 293T cells reaches 80%, use lipofectamine 2000 for cell transfection.

[0017] The ratio of transfection reagents is as follows:

[0018] Sterile EP tube 1:

[0019]

[0020] Sterile EP tube 2:

[0021]

[0022] After mixing tube 1 and tube 2 evenly, absorb the liquid in tube 2 and put it in tube 1, shake it gently and mix well, then put it in the ultra-c...

Embodiment 2

[0026] The expression situation of luciferase in the monoclonal cell of embodiment 2

[0027] 1. Dissolve D-fluorescein salt (YEASEN 40902ES03) in distilled water and prepare it as a 30mg / ml stock solution (200x).

[0028] 2. Dilute the stock solution 1:200 with the preheated culture medium to prepare the working concentration (150μg / ml).

[0029] 3. A total of 17 plates of cells, the original medium in the culture dish was discarded, normal Huh7 cells were treated without fluorescein working solution and normal Huh7 cells were treated with fluorescein working solution as controls, and monoclonal Huh7-luc was picked Cells 1-15 were treated with fluorescein working solution as the experimental group, incubated at 37°C for 10 minutes, and then detected the fluorescence intensity with a BioTek microplate reader. The result is as figure 1 As shown, the selected monoclonal cell 7 is a cell line overexpressing luciferase.

example 3

[0030] Example 3 Verification of Huh7-luciferase stable overexpression cell line

[0031] 1. Extract the RNA of Huh7 and Huh7-luciferase cells according to the literature "Targeting KDM1A attenuates Wnt / β-catenin signaling pathway to eliminate sorafenib-resistant stem-like cells in hepatocellular carcinoma, Huang M, Cancer Lett. 2017Jul 10; 398:12-21", and then Reverse transcribed into cDNA and tested by RT-PCR.

[0032] 2. The primer sequences required to detect the Luciferase gene are as follows:

[0033] 5'CTGAACAGCATGGGCATCA 3'(sense)

[0034] 5'AAATGGGAAGTCACGAAGGT 3'(antisense)

[0035] 3. The reaction system is as follows:

[0036] system 25μl DNA template (100ng / μl) 5μl Double primer (2μM) 3μl Es-tag enzyme (Takara RR902Q) 12.5μl wxya 2 o

to 25μl

[0037] 4. Reaction conditions

[0038]

[0039] The result is as figure 2 shown.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for constructing a luciferase high-expressed Huh7 cell line. A luciferase high-expressed Huh7 cell line is obtained by adopting a lentiviral vector. According to the method, firstly, a luciferase gene is transferred into a Huh7 cell line by utilizing a lentiviral infection technology, so that the luciferase gene can be expressed in the Huh7 cell; and then, a cell over-expressing luciferase is screened by adopting a method for selecting monoclonal cells, and mass amplification is performed to obtain the Huh7 cell line stably over-expressing the luciferase. The Huh7 cell line stably high expressing luciferase can be used as a specific marker to detect the part of a cell existing in an animal body and can be used for studying a tumor metastasis model.

Description

technical field [0001] The invention relates to cell biology technology, in particular to a method for infecting liver cancer cell Huh7 with a lentiviral vector expressing a luciferase gene, and obtaining a stable and high-expressing Luciferase Huh7 cell line using a monoclonal screening technique. Background technique [0002] Discovery of Luciferase [0003] Luciferase Luciferase belongs to a class of oxidoreductases. in Mg 2+ In the presence of , ATP and oxygen, Luciferase catalyzes the oxidation of the substrate luciferin to oxyluciferin, which emits visible green light. Its reaction formula can be expressed as: [0004] Luciferin+ATP+Luciferase+O 2 +Mg 2+ —Oxyluciferin+AMP+PPi+CO 2 + light. [0005] Luciferase has high sensitivity, short half-life, good specificity, good stability, simple operation, rapid response, does not affect the normal growth and reproduction of organisms, and has no toxic effect on organisms. It can be used as a biomarker for in vivo imag...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/02C12N15/867C12N5/10C12R1/91
CPCC12N9/0004C12N15/86C12N5/0693C12N2510/00
Inventor刘扬耿鹏宇
OwnerDALIAN INST OF CHEM PHYSICS CHINESE ACAD OF SCI