Primer group for rapid detection of 2019-nCoV based on CRISPR technology and application thereof
A 2019-ncov, detection primer technology, used in microorganism-based methods, recombinant DNA technology, and microbial assay/inspection. The effect of advantage
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Example Embodiment
[0055] Example 1
[0056] Design of 2019-nCoV CRISPR detection primer sequence.
[0057] 1. The target sequence is selected.
[0058] The novel coronavirus (2019-nCoV) is a newly discovered coronavirus. The inventors analyzed the sequence of 2019-nCoV and believed that the Orf1ab gene and the N gene are conservative genes of the coronavirus and can be designed according to the conservative sequence. Point the Orf1ab gene and N gene sequence regions, design crRNA and RPA amplification primers, and test the sensitivity of the detection method.
[0059] The samples to be tested in this example are plasmids (synthesized by AGI Biotechnology Co., Ltd.) into which a segment of the target sequence region selected by 2019-nCoV is inserted. The inserted sequence of Orf1ab gene is as follows:
[0060] 5'-ATGCCTTCAAACTCAACATTAAATTGTTGGGTGTTGGTGGCAAACCTTGTATCAAAGT AGCCACTGTACAGTCTAAAATGTCAGATGTAAAGTGCACATCAGTAGTCTTACTCTCAGT TTTGCAACAACTCAGAGTAGAATCATCATCTAAATTGTGGGCTCAATGTGTCCAGTTACA CAATGACATTCT...
Example Embodiment
[0071] Example 2
[0072] 1. Screening the amplification efficiency of RPA amplification primers.
[0073] In order to screen the RPA amplification primers of Cas13a, the plasmid with the gene sequence of the Orf1ab gene and the N gene inserted into the two targets of 2019-nCoV in Example 1 was used as the standard sample to be tested, and the standard sample was extracted according to the conventional method. Gene, the primers for the target Orf1ab gene (primers shown in Table 1 above) are combined in two sets with Orf1ab-crRNA-1, and the primers for the target N gene (primers shown in Table 2 above) are paired Combine and cooperate with N-crRNA-1 for detection and screening, and the template concentration is 1000copies / μl.
[0074] 1.1 Method.
[0075] Reaction system: upstream primer (0.1-0.6μM) 0.5-2.5μL, downstream primer (0.1-0.6μM) 0.5-2.5μL, RPA enzyme master mix 21μL, magnesium acetate (10-20mM) 0.5-2μL, signal reporter probe (50-400nM) 1μl, NTP mix (0.2-6mM) 1-10μL, T7 RNA...
Example Embodiment
[0096] Example 3
[0097] This example is based on RPA amplification, T7 in vitro transcription and Cas13a for sensitivity detection.
[0098] Take the plasmids with the conservative sequence of nCoV-Orf1ab gene and the conservative sequence of nCoV-N gene as template, and calculate the dilution to 3000copies / μL, 300copies / μL, 30copies / μL, 3copies / μL, 1copy / μL, 0.4copy / μL A total of 7 gradients of 0.16copy / μL are used as templates for sensitivity detection, and the amount of template added to each reaction is 2.5μL.
[0099] 1. Method.
[0100] With reference to the method in Example 2 above, sensitivity analysis was performed on the nCoV-Orf1ab target and the nCoV-N target respectively, and a negative control was set for the experiment.
[0101] Reaction conditions: react at 42°C for 40-60min, read FAM fluorescence value every 1min.
[0102] Refer to the result interpretation method in Example 2 above for result interpretation.
[0103] 2. Results.
[0104] Use ABI7500 fluorescence detec...
PUM
Property | Measurement | Unit |
---|---|---|
Upstream primer | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2023 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap