Cell line for knocking out porcine IRF8 gene based on CRISPR-Cas9 editing technology and construction method of cell line
A cell line and gene technology, applied in other methods of inserting foreign genetic material, cells modified by introducing foreign genetic material, genetic engineering, etc., can solve the problem that there is no porcine IRF8 gene intestinal epithelial cell model, etc. Simple and efficient knockout effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] 1. Target site design and sgRNA sequence synthesis:
[0050] According to the NCBI database (https: / / www.ncbi.nlm.nih.gov / ), the transcript CDS sequence of the porcine IRF8 gene (accession number: NM_001252427.2) was obtained, and the knockout target site was designed according to the 5' end of the CDS region , using CRISPRDesign (http: / / crispr.mit.edu / ) to design three sgRNA guide sequences sgRNA1, sgRNA2 and sgRNA3,
[0051] sgRNA1: CCGTTCCGGTCGCACATCCTCGG;
[0052] sgRNA2: aggATGTGCGACCGGAACGGCGG;
[0053] sgRNA3: GGATCCGGAACATGCTCTTCTGG.
[0054] Add base CACC to the 5' end of the three sgRNA guide sequences and remove the PAM (NGG) sequence at the 3' end to form a positive-strand sgRNA sequence (note that if the first base at the 5' end of the sgRNA sequence is not G, you need to Add CACCG, the first base is G, only need to add CACC); reverse complement the three sgRNA guide sequences designed, and add base AAAC to the 5' end to form a negative strand sgRNA sequ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com