Therapeutic agents comprising isolated recombinant oncolytic adenoviruses and immune cells and uses thereof

An oncolytic adenovirus and immune cell technology, applied in the direction of medical preparations containing active ingredients, drug combinations, anti-tumor drugs, etc., can solve problems affecting the effect of tumor treatment, reduce protein expression levels, and enhance anti-tumor immunity Killing effect, safety-enhancing effect

Pending Publication Date: 2020-10-09
BEIJING CONVERD CO LTD
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, both TCR-T and CAR-T based immunotherapy exhibit various shortcomings, which affect the therapeutic effect of tumors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Therapeutic agents comprising isolated recombinant oncolytic adenoviruses and immune cells and uses thereof
  • Therapeutic agents comprising isolated recombinant oncolytic adenoviruses and immune cells and uses thereof
  • Therapeutic agents comprising isolated recombinant oncolytic adenoviruses and immune cells and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 4

[0257] MTT method used in Example 4: Add 10 μl of MTT solution (5 mg / ml) to each well of cells, incubate for 4 hours in a 37° C. The crystals were fully dissolved and mixed, and their absorbance at 490 nm (OD 490 ). Inhibition rate calculation formula: cell proliferation inhibition percentage (IR%)=1-(OD 490 Test article-OD 490 Blank) / (OD 490 negative control-OD 490 Blank) × 100%.

[0258] Counting by trypan blue staining: wash cells with PBS, digest with trypsin, suspend cells in PBS, add trypan blue staining solution with a final concentration of 0.04% (w / v), count under a microscope, dead cells will be Stain light blue, live cells are rejected. The number of living cells was taken as the final data.

[0259] Sources of culture plates: 6-well cell culture plates (the culture volume of each well is 2 ml), 12-well cell culture plates (1 ml of culture volume per well), 24-well cell culture plates (500 μl of culture volume per well) adopted in each example, All 96-well c...

Embodiment 11

[0265] The MTT method used in embodiment 11 illustrates:

[0266] Digest the cells in the logarithmic growth phase with trypsin, collect them by centrifugation after termination, blow them evenly, and prepare a single-cell suspension; ), inoculated in a 96-well cell culture plate with a culture system of 100 μl / well, placed at 37°C, 5% CO 2 Cultivate in an incubator overnight to make the cells completely adhere to the wall and reach 70-80% the next day; the counting method is counted by a counting plate, and the correctness of the counting is verified by a countstar counter. Take out the 96-well plate, add 100 μl pre-prepared T cell and TCR-T cell suspension, vortex slightly before adding the sample, add 100 μl serum-free medium for corresponding cell culture in the blank control well; place at 37°C, 5% CO 2 Culture in the incubator for 24 hours respectively; after 24 hours, take the cells, centrifuge at 400g, absorb 180 μl of medium after 10 minutes and put them into a new 9...

preparation example 1

[0271] Preparation Example 1: Construction of E1A Gene Expression Vector

[0272] According to the human adenovirus type 5 (AD5) genome DNA sequence (ACCESSION: AC_000008) in the Genbank of NCBI (that is, the National Center for Biotechnology Information, website: https: / / www.ncbi.nlm.nih.gov) design two PCR primers (P1: GGA AGATCT GGACTGAAAATGAG (SEQ ID No.30), P2: TGAGGTCAGATGTAACCAAGATTA (SEQ ID No.31); note: the 5' end of the primer P1 has added a BglII restriction site, underlined); extract Shanghai Sanwei Biotechnology Co., Ltd. Oncolytic virus (H101) genomic DNA was used as a template for high-fidelity PCR amplification of the 1164bp sequence between 551-1714 on the AD5 genomic DNA, and the actual size was 1173bp (see figure 1 ), this sequence includes the coding region of the E1A gene (excluding the E1A promoter sequence) and part of the 3'UTR region. Utilize the PCR product that BglII digestion obtains, and it is cloned between the BglII and the EcoRV site in the m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a therapeutic agent comprising isolated recombinant oncolytic adenoviruses and immune cells and uses thereof. The therapeutic agent comprises: a tfirst composition, wherein the first composition comprises a first active ingredient located in a first pharmaceutically acceptable carrier, wherein the first active component comprises an isolated recombinant oncolytic adenovirus, the recombinant oncolytic adenovirus is a selective replication type oncolytic adenovirus, and a coding sequence of exogenous shRNA capable of inhibiting PDL1 expression in tumor cells is integrated in a genome of the recombinant oncolytic adenovirus; and a second composition wherein the second composition comprises a second active ingredient located in a second pharmaceutically acceptable carrier, the second active ingredient comprising T cell receptor modified immune cells or chimeric antigen receptor modified immune cells. According to the invention, the oncolytic adenovirus and the immune cells are combined for use to realize a synergistic treatment effect, and the administration mode enriches the treatment mode and treatment means of tumor treatment.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a therapeutic agent and application, a kit, and a method for treating tumors and / or cancers comprising isolated recombinant oncolytic adenoviruses and immune cells. Background technique [0002] According to the latest report on the cause of population death published on the website of the World Health Organization in January 2013, about 7.6 million people died of cancer in the world in 2008, accounting for 13% of the total number of deaths in the world, and this number is still growing rapidly every year. In 2030, this number will exceed 13.1 million. In my country, the incidence of malignant tumors is increasing at an average annual rate of 3% to 5%. In 2002, there were 2.19 million new cases of malignant tumors in the country every year. By 2020, the number of new cases will exceed 3 million. Cancer has become one of the leading causes of death in the world. Moreover...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K35/761A61K35/17A61P35/00
CPCA61K35/761A61P35/00A61K39/4611A61K2239/31A61K2239/50A61K2239/38A61K39/4632A61K39/464406A61K2300/00A61K35/768C12N15/861
Inventor绳纪坡侯亚非翁立红谭贤魁董小明王雪胡放
OwnerBEIJING CONVERD CO LTD