A high-efficiency combination and breeding method of Hehua carp

A technology for the combination of grass and carp, which is applied in biochemical equipment and methods, recombinant DNA technology, and the determination/inspection of microorganisms. The effect of protection and sustainable utilization, avoiding inbreeding decline, and improving breeding efficiency

Active Publication Date: 2021-07-20
HEILONGJIANG RIVER FISHERY RES INST CHINESE ACADEMY OF FISHERIES SCI +1
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, since molecular markers such as microsatellite markers are distributed throughout the genome, although the genetic distance calculated based on this can reflect the genetic differences between parents, it cannot reflect the genetic differences between parents in target traits, and the addition of loci that have nothing to do with target traits Can not improve the efficiency of breeding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A high-efficiency combination and breeding method of Hehua carp
  • A high-efficiency combination and breeding method of Hehua carp
  • A high-efficiency combination and breeding method of Hehua carp

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment approach 1

[0014] Specific implementation mode one: the high-efficiency mating and breeding method of Hehua carp in this embodiment is carried out according to the following steps:

[0015] 1. Select broodstock groups of Hehua carp, implant electronic markers, and establish electronic files;

[0016] 2. Analyze the genotype and genetic composition of the broodstock population: a. collect parental blood or fin ray tissue, and extract genomic DNA; b. amplify genomic DNA with 20 QTLs of body weight and body length; c. use capillary coagulation Gel electrophoresis analysis of PCR products to obtain genotype data;

[0017] 3. Use genetic analysis software to calculate the genetic structure of the parent fish population and the genetic distance between individuals and draw a clustering tree, divide the breeding group, and then select the genetic distance between female and male individuals from the breeding group with a genetic distance of 0.8 to 1.0 and be able to enrich Parental individuals...

specific Embodiment approach 2

[0026] Specific embodiment two: the difference between this embodiment and specific embodiment one is: the extraction method of the genomic DNA sample of the broodstock population of the grass carp in step 2a is: adopt the genome DNA extraction kit to extract from the blood or fin rays of the grass carp Genomic DNA was extracted and purified from the tissue, and then the purity and concentration were measured with an ultraviolet spectrophotometer, and the genomic DNA was diluted to 50ng / μL. Other steps and parameters are the same as those in the first embodiment.

specific Embodiment approach 3

[0027] Specific embodiment three: the difference between this embodiment and specific embodiment one is: in step 2b, the QTLs of body weight and body length of 20 carps are located on 14 linkage groups of carp high-density genetic map, and the names and primer sequences are respectively for:

[0028] QTL HLJ3579

[0029] Upstream primer: GCAAATAGAAGGTAAATGAAATCG

[0030] Downstream primer: CGGAGCAGTGGGTGTGAT

[0031] QTL HLJ2424

[0032] Upstream primer: TTAGAACGGGAAGGCAAGG

[0033] Downstream primer: GCTTTTGTTTCACCCCTGGAT

[0034] QTL CAFS724

[0035] Upstream primer: TAAGGTTTGGGAGGACAGGT

[0036] Downstream primer: ATTCAAACCACCCTCACAAG

[0037] QTL HLJ2456

[0038] Upstream primer: CTCTCTACGCTTGGGCTGTA

[0039] Downstream primer: CATTTCCACACTATCCTTATCCA

[0040] QTL HLJ3460

[0041] Upstream primer: GAGTTTTTCTTACAGTCTTGTGTTGT

[0042] Downstream primer: TTACGCCATCCTCATCATCATCA

[0043] QTL CAFS2278

[0044] Upstream primer: TAGCCACACTTAAATAGACG

[0045] Downst...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
body lengthaaaaaaaaaa
Login to View More

Abstract

A high-efficiency mating and breeding method for Hehua carp, the invention relates to a breeding method for Hehua carp. The invention protects and continuously utilizes the original species of the Hehua carp, and improves the production performance of the original species of the Hehua carp. Methods: 1. Select, mark, and file the Hehua carp; 2. Analyze the genotype and genetic composition of the broodstock population of the Hehua carp; 3. Use software to analyze and carry out mating breeding; Complete breeding. The method of the invention protects and continuously utilizes the original seed of the Hehua carp, and improves the production performance of the original seed of the Hehua carp.

Description

technical field [0001] The invention relates to a breeding method of the grass carp. Background technique [0002] Cyprinus carpio L. is native to Guilin, Guangxi. It is named after eating grass flowers in rice fields. It is the most characteristic species of rice and fish in Guangxi. Hehua carp has a short body, thin scales, thin skin, tender meat, and delicious taste. In recent years, with the rice-fishing comprehensive breeding model, it has been rapidly promoted nationwide. At present, the seed production of Hehua carp is mainly self-propagation and self-breeding, and inbreeding is serious; a few breeding units carry out group or family selection for phenotypic traits and growth traits, but the problem of controlling inbreeding has not been resolved. On the other hand, due to the increasing number of seedlings of hybrid Hehua carp, germplasm mixing has a great impact on Hehua carp, a fish species with a long history of breeding. Therefore, it is imminent to protect and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6888C12Q1/6858C12N15/11
CPCC12Q1/6858C12Q1/6888C12Q2600/124C12Q2600/156C12Q2531/113C12Q2565/125
Inventor鲁翠云陈忠李超杜雪松郑先虎程磊孙志鹏
OwnerHEILONGJIANG RIVER FISHERY RES INST CHINESE ACADEMY OF FISHERIES SCI