Construction method and application of PCSK9 humanized mouse model
A technology of mouse model and construction method, which is applied in the field of animal genetic engineering and genetic modification, can solve the problems of interfering with human target antibody screening and drug efficacy evaluation, and achieve excellent specific effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0080] Example 1 Establishment of PCSK9 humanized mouse model
[0081] Using CRISPR Cas9 to replace the mouse PCSK9 gene with the human PCSK9 gene, a mouse model that can express human PCSK9 was constructed. C57BL / 6J mouse is a well-developed mouse strain at present. With C57BL / 6J mouse as the background mouse, a PCSK9 humanized mouse model has been successfully obtained.
[0082] (1) Determine the replacement region of the human fragment and the inserted human sequence
[0083] MousePCSK9 gene has 1 transcript, PCSK9-201 (ENSMUST00000049507.5) transcript. HumanPCSK9 gene has two transcripts. We selected the CDS (NM_174936.4) of the PCSK9-201 (ENST00000302118.5) transcript corresponding to the mouse to replace the human gene in the mouse. The sequence of the human insert is (SEQ ID NO: 1):
[0084] ATGGGCACCGTCAGCTCCAGGCGGTCCTGGTGGCCGCTGCCACTGCTGCTGCTGCTGCTGCTGCTCCTGGGTCCCGCGGGCGCCCGTGCGCAGGAGGACGAGGACGGCGACTACGAGGAGCTGGTGCTAGCCTTGCGTTCCGAGGAGGACGGCCTGGCCGAAGCACCCGAGCACGGA...
Embodiment 2
[0112] Example 2 Verification of human PCSK9 expression and blood lipid level in humanized PCSK9 mice
[0113] Detect the expression level of human PCSK9 in the humanized B6-hPCSK9 mouse liver obtained by the present invention by quantitative PCR and Western Blot technology, and collect the blood of wild-type and humanized PCSK9 mice at the same time and use a blood biochemical analyzer to analyze LDL- C level. The results showed that the liver of B6-hPCSK9 mice only expressed human PCSK9 mRNA and protein but not murine Psck9 mRNA and protein, and the protein expression level of LDLR, an important receptor involved in cholesterol metabolism directly regulated by PCSK9 protein, was not affected . The analysis results of blood LDL-C (low-density lipoprotein cholesterol) also showed that the level of LDL-C in the blood of B6-hPCSK9 mice was consistent with that of wild-type mice. The above analysis results show that the B6-hPCSK9 mice involved in this patent successfully expres...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap