Supercharge Your Innovation With Domain-Expert AI Agents!

Construction method and application of PCSK9 humanized mouse model

A technology of mouse model and construction method, which is applied in the field of animal genetic engineering and genetic modification, can solve the problems of interfering with human target antibody screening and drug efficacy evaluation, and achieve excellent specific effects

Pending Publication Date: 2020-11-24
GEMPHARMATECH CO LTD
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most of the PCSK9 humanized mouse models that have been reported so far mainly overexpress the full-length human PCSK9. On the one hand, the mouse PCSK9 still exists in the model mice, which may interfere with the screening and efficacy evaluation of human target antibodies; On the one hand, mice overexpressing PCSK9 will spontaneously develop a hyperlipidemia phenotype, which is no longer suitable for the construction of a special diet-induced hyperlipidemia model

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method and application of PCSK9 humanized mouse model
  • Construction method and application of PCSK9 humanized mouse model
  • Construction method and application of PCSK9 humanized mouse model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0080] Example 1 Establishment of PCSK9 humanized mouse model

[0081] Using CRISPR Cas9 to replace the mouse PCSK9 gene with the human PCSK9 gene, a mouse model that can express human PCSK9 was constructed. C57BL / 6J mouse is a well-developed mouse strain at present. With C57BL / 6J mouse as the background mouse, a PCSK9 humanized mouse model has been successfully obtained.

[0082] (1) Determine the replacement region of the human fragment and the inserted human sequence

[0083] MousePCSK9 gene has 1 transcript, PCSK9-201 (ENSMUST00000049507.5) transcript. HumanPCSK9 gene has two transcripts. We selected the CDS (NM_174936.4) of the PCSK9-201 (ENST00000302118.5) transcript corresponding to the mouse to replace the human gene in the mouse. The sequence of the human insert is (SEQ ID NO: 1):

[0084] ATGGGCACCGTCAGCTCCAGGCGGTCCTGGTGGCCGCTGCCACTGCTGCTGCTGCTGCTGCTGCTCCTGGGTCCCGCGGGCGCCCGTGCGCAGGAGGACGAGGACGGCGACTACGAGGAGCTGGTGCTAGCCTTGCGTTCCGAGGAGGACGGCCTGGCCGAAGCACCCGAGCACGGA...

Embodiment 2

[0112] Example 2 Verification of human PCSK9 expression and blood lipid level in humanized PCSK9 mice

[0113] Detect the expression level of human PCSK9 in the humanized B6-hPCSK9 mouse liver obtained by the present invention by quantitative PCR and Western Blot technology, and collect the blood of wild-type and humanized PCSK9 mice at the same time and use a blood biochemical analyzer to analyze LDL- C level. The results showed that the liver of B6-hPCSK9 mice only expressed human PCSK9 mRNA and protein but not murine Psck9 mRNA and protein, and the protein expression level of LDLR, an important receptor involved in cholesterol metabolism directly regulated by PCSK9 protein, was not affected . The analysis results of blood LDL-C (low-density lipoprotein cholesterol) also showed that the level of LDL-C in the blood of B6-hPCSK9 mice was consistent with that of wild-type mice. The above analysis results show that the B6-hPCSK9 mice involved in this patent successfully expres...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a construction method and application of a PCSK9 humanized mouse model. According to the invention, CDS (NM _ 174936.4) of a PCSK9-201 transcript corresponding to a fragment of a PCSK9-201 gene in a mouse is selected and subjected to human-derived gene replacement on the mouse; a positive F1-generation mouse is obtained through the steps of designing, construction and purification of a targeting vector, in-vitro transcription, microinjection of Cas9 / sgRNA, identification and hereditability detection of an F0-mouse and the like; and the expression of humanized PCSK9 inthe hPCSK9 mouse and the blood lipid level of the mouse are verified, and verification results show that the hPCSK9 mouse constructed according to the method disclosed by the invention can successfully and well express a humanized PCSK9 protein, the LDL-C level of blood in a background state is normal, and the humanized PCSK9 protein can be adopted as the humanized animal model to induce a hyperlipidemia disease model and can be used for the screening and the drug effect evaluation of targeted PCSK9 humanized antibodies or drugs.

Description

technical field [0001] The invention belongs to the field of animal genetic engineering and genetic modification, and in particular relates to a method for constructing a humanized animal model of PCSK9 gene modification based on gene editing technology. Background technique [0002] According to the statistics of the World Health Organization, 17.9 million people die of cardiovascular diseases worldwide every year. Cardiovascular diseases are still the leading cause of death from human diseases, higher than tumors and other diseases. The prevalence of cardiovascular disease in China is also on the rise. According to the "China Cardiovascular Disease Report 2017", there are about 290 million patients with cardiovascular disease in my country. In 2015, 2 out of 5 deaths were caused by Cardiovascular diseases. Dyslipidemia is one of the important factors causing cardiovascular diseases such as atherosclerosis. According to CHNS in 2002, China Chronic Kidney Disease Working Gr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/90C12N15/57A01K67/027
CPCA01K67/0278A01K2207/15A01K2217/072A01K2227/105A01K2267/0362C12N9/6454C12N15/8509C12N15/907C12Y304/21061
Inventor 琚存祥赵静陈中杨笑柳
Owner GEMPHARMATECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More