Construction method of mouse model capable of specifically expressing PIK3C3 S282A in pancreatic acinar cells
An acinar cell, mouse model technology, applied in the field of medicine, can solve the problem of unknown effect of pancreatic enzyme activation, and achieve the effect of expanding the scope and strong specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0094] Example 1: Construction of human PRSS1 promoter-Cre exogenous plasmid
[0095] Search the NCBI database to find the promoter sequence of the human PRSS1 gene, as shown in SEQ ID NO.1. Promoter of human PRSS1 gene (SEQ ID NO.1):
[0096] Use the BAC (Bacterial Artificial Chromosome, bacterial artificial chromosome) cloning method to construct the human PRSS1 promoter-Cre exogenous plasmid, and the structure diagram is as follows figure 2 shown. Enzyme digestion identification, the digestion reaction system is: 20μl system, including 700ng PRSS1 promoter-Cre plasmid, 2μl 10X digestion buffer, 0.5μl endonuclease (any one of BamHI, XhoI, ApaLI, KpnI, PvμI and NotI a) and a balance of H 2 O, incubated at 37°C for 1h, the results were as follows image 3 shown. After sequencing, the sequence of the human PRSS1 promoter-Cre exogenous plasmid is shown in SEQ ID NO.2. Among them, endonucleases BamHI, XhoI, ApaLI, KpnI, PvμI and NotI were purchased from NEB Company. The r...
Embodiment 2
[0097] Example 2: Constructing the foreign plasmid of LoxP-PIK3C3
[0098] Search the NCBI database to find the mouse PIK3C3 gene information (refer to NCBI: NM_181414.6), the gene includes 25 exons. The exogenous plasmid of LoxP-PIK3C3 was constructed by BAC cloning method, and the exogenous plasmid also included the mutation sequence of S282A (TCT changed to GCT). The schematic diagram of the structure of the exogenous plasmid is as follows: Figure 4 shown. Enzyme digestion identification, the enzyme digestion reaction system is: 20μl system, including 700ng LoxP-PIK3C3 exogenous plasmid, 2μl digestion buffer, 0.5μl endonuclease (EcoRI, EcoRV, ApaLI, Af1II, AvrII, DrdI and NotI in any one of ) and the margin is H 2 O, incubated at 37°C for 1h, the results were as follows Figure 5 shown. After DNA sequencing, the sequence of the foreign plasmid containing LoxP-PIK3C3 is shown in SEQ ID NO.3. Among them, endonucleases EcoRI, EcoRV, ApaLI, Af1II, AvrII, DrdI and NotI we...
Embodiment 3
[0099] Example 3: Preparation of PRSS1-Cre mice
[0100] The site targeted by the gRNA is located on mouse chromosome 11: +3145142, and the sequence is gaacactagtgcacttatcctgg (SEQ ID NO.4).
[0101] The human PRSS1 promoter-Cre exogenous plasmid obtained in Example 1, the Cas9 gene and the gRNA shown in SEQ ID NO.4 were injected into the fertilized mouse eggs together, and the mouse tail genomic DNA of the progeny was extracted, followed by PCR Identification and Southern blot identification, to obtain PRSS1-Cre mice (identification results such as Figure 6-Figure 11 ).
[0102] The primers identified by PCR are shown in SEQ ID NO.5-SEQ ID NO.8, specifically:
[0103]F1 (SEQ ID NO.5): 5'-gtacatccacagcatcttccaag-3';
[0104] R1 (SEQ ID NO.6): 5'-atgagggttagaaggagggagaatg-3';
[0105] F2 (SEQ ID NO.7): 5'-gcatctgacttctggctaataaag-3';
[0106] R2 (SEQ ID NO. 8): 5'-gccttgacctaagagatgatgcgac-3'.
[0107] The reaction system identified by PCR is one of the following two typ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More