Unlock instant, AI-driven research and patent intelligence for your innovation.

Construction method of mouse model capable of specifically expressing PIK3C3 S282A in pancreatic acinar cells

An acinar cell, mouse model technology, applied in the field of medicine, can solve the problem of unknown effect of pancreatic enzyme activation, and achieve the effect of expanding the scope and strong specificity

Active Publication Date: 2020-12-04
AFFILIATED HOSPITAL OF GUILIN MEDICAL UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the effect of phosphorylation of PIK3C3 S282 on pancreatic enzyme activation is currently unknown, and there is no mouse that specifically expresses the PIK3C3 S282A mutant in pancreatic acinar cells in the prior art, so it is necessary to construct such a mouse

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of mouse model capable of specifically expressing PIK3C3 S282A in pancreatic acinar cells
  • Construction method of mouse model capable of specifically expressing PIK3C3 S282A in pancreatic acinar cells
  • Construction method of mouse model capable of specifically expressing PIK3C3 S282A in pancreatic acinar cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0094] Example 1: Construction of human PRSS1 promoter-Cre exogenous plasmid

[0095] Search the NCBI database to find the promoter sequence of the human PRSS1 gene, as shown in SEQ ID NO.1. Promoter of human PRSS1 gene (SEQ ID NO.1):

[0096] Use the BAC (Bacterial Artificial Chromosome, bacterial artificial chromosome) cloning method to construct the human PRSS1 promoter-Cre exogenous plasmid, and the structure diagram is as follows figure 2 shown. Enzyme digestion identification, the digestion reaction system is: 20μl system, including 700ng PRSS1 promoter-Cre plasmid, 2μl 10X digestion buffer, 0.5μl endonuclease (any one of BamHI, XhoI, ApaLI, KpnI, PvμI and NotI a) and a balance of H 2 O, incubated at 37°C for 1h, the results were as follows image 3 shown. After sequencing, the sequence of the human PRSS1 promoter-Cre exogenous plasmid is shown in SEQ ID NO.2. Among them, endonucleases BamHI, XhoI, ApaLI, KpnI, PvμI and NotI were purchased from NEB Company. The r...

Embodiment 2

[0097] Example 2: Constructing the foreign plasmid of LoxP-PIK3C3

[0098] Search the NCBI database to find the mouse PIK3C3 gene information (refer to NCBI: NM_181414.6), the gene includes 25 exons. The exogenous plasmid of LoxP-PIK3C3 was constructed by BAC cloning method, and the exogenous plasmid also included the mutation sequence of S282A (TCT changed to GCT). The schematic diagram of the structure of the exogenous plasmid is as follows: Figure 4 shown. Enzyme digestion identification, the enzyme digestion reaction system is: 20μl system, including 700ng LoxP-PIK3C3 exogenous plasmid, 2μl digestion buffer, 0.5μl endonuclease (EcoRI, EcoRV, ApaLI, Af1II, AvrII, DrdI and NotI in any one of ) and the margin is H 2 O, incubated at 37°C for 1h, the results were as follows Figure 5 shown. After DNA sequencing, the sequence of the foreign plasmid containing LoxP-PIK3C3 is shown in SEQ ID NO.3. Among them, endonucleases EcoRI, EcoRV, ApaLI, Af1II, AvrII, DrdI and NotI we...

Embodiment 3

[0099] Example 3: Preparation of PRSS1-Cre mice

[0100] The site targeted by the gRNA is located on mouse chromosome 11: +3145142, and the sequence is gaacactagtgcacttatcctgg (SEQ ID NO.4).

[0101] The human PRSS1 promoter-Cre exogenous plasmid obtained in Example 1, the Cas9 gene and the gRNA shown in SEQ ID NO.4 were injected into the fertilized mouse eggs together, and the mouse tail genomic DNA of the progeny was extracted, followed by PCR Identification and Southern blot identification, to obtain PRSS1-Cre mice (identification results such as Figure 6-Figure 11 ).

[0102] The primers identified by PCR are shown in SEQ ID NO.5-SEQ ID NO.8, specifically:

[0103]F1 (SEQ ID NO.5): 5'-gtacatccacagcatcttccaag-3';

[0104] R1 (SEQ ID NO.6): 5'-atgagggttagaaggagggagaatg-3';

[0105] F2 (SEQ ID NO.7): 5'-gcatctgacttctggctaataaag-3';

[0106] R2 (SEQ ID NO. 8): 5'-gccttgacctaagagatgatgcgac-3'.

[0107] The reaction system identified by PCR is one of the following two typ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method of a mouse model capable of specifically expressing PIK3C3 S282A in pancreatic acinar cells, and belongs to the technical field of medicines. The construction method comprises the following steps: constructing a human PRSS1 promoter-Cre exogenous plasmid; constructing an exogenous plasmid of LoxP-PIK3C3; preparing a PRSS1-Cre mouse; preparing LoxP-PIK3C3 embryonic stem cells; preparing a LoxP-PIK3C3 mouse; and preparing a mouse capable of specifically expressing PIK3C3 S282A in pancreatic acinar cells. According to the invention, a novel promoter specifically expressed by pancreatic acinar cells, namely a human PRSS1 promoter, is introduced into a Cre-LoxP system, so that the gene editing range is expanded, and the specificity of the promoter is stronger than that of a rat CELA1 promoter in the prior art.

Description

technical field [0001] The invention relates to a method for constructing a mouse model specifically expressing PIK3C3 S282A in pancreatic acinar cells, belonging to the technical field of medicine. Background technique [0002] Acute pancreatitis is a disease in which inflammation occurs in the pancreas. The disease begins with damage to pancreatic acinar cells and progresses to systemic inflammation. So far, the mechanism of pancreatic acinar cell injury has not been fully understood. The construction of transgenic mice brings convenience and more reliable evidence for the study of the mechanism of acinar injury. According to the location and time of gene editing, transgenic mice are divided into complete transgenic mice and conditional transgenic mice. Wherein, the complete transgenic mouse means that the editing of the target gene exists in all cells of the mouse, and runs through the entire developmental (survival) stages of the mouse. The conditional transgenic mice...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/90C12N15/54A01K67/027C12Q1/6888
CPCC12N15/8509C12N15/907C12N9/1205A01K67/0275C12Q1/6888C12N2800/107C12N2800/30C12N2830/008A01K2217/072A01K2227/105A01K2267/03C12Q2600/124
Inventor 肖娟张鹏程周袁刘丙刚
Owner AFFILIATED HOSPITAL OF GUILIN MEDICAL UNIV