Preparation method of animal model with high expression of genes transfected through endotracheal pathway in lung tissues

An animal model, lung tissue technology, applied in the fields of botanical equipment and methods, biochemical equipment and methods, and devices for restraining animals, etc., can solve problems such as difficulty in controlling drug doses, reducing the success rate of puncture, and limiting experimental progress. Achieve the effect of improving transfection targeting, good practicability, and speeding up the experimental process

Pending Publication Date: 2020-12-25
THE FIRST TEACHING HOSPITAL OF XINJIANG MEDICAL UNIVERCITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The transfection of adenovirus through the tail vein can reach the lungs, so that the target gene can be expressed in the lung tissue. However, the newborn rats are small in weight, with slender tail veins, difficult puncture, and the blood volume of the tail veins is very small, and the return of blood is not obvious. Only a small amount of medicine can judge whether the puncture is successful, and once the puncture is unsuccessful, repeated puncture and repeated injection of drugs can cause tail edema, further increase the difficulty of puncture, reduce the success rate of puncture, and repeated puncture will cause difficulty in drug dose control and drug waste , so in order to improve the success rate of puncture, researchers often need to wait for the newborn rats to reach a certain body weight before starting the experiment, which limits the experimental process
Intratracheal administration is another important way to deliver drugs to the lungs. However, there is no relevant report on the targeted transfection of recombinant adenovirus vectors in the lung tissue of neonatal rats through the intratracheal route.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of animal model with high expression of genes transfected through endotracheal pathway in lung tissues
  • Preparation method of animal model with high expression of genes transfected through endotracheal pathway in lung tissues
  • Preparation method of animal model with high expression of genes transfected through endotracheal pathway in lung tissues

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 Constructing a recombinant adenovirus vector carrying VEGF-A

[0038]1. Construction of VEGF-A overexpression adenovirus vector: the name of the vector is GV314 (element sequence: CMV-MCS-3FLAG-SV40-EGFP), the vector is linearized by digestion with BamHI / AgeI, and the human source of the target gene is amplified by PCR For VEGF-A, the PCR reaction system is shown in Table 1, and the amplification product is shown in figure 1 , the specific sequence of the amplification primer is as follows:

[0039] VEGFA(4907-1)-P1: AGGTCGACTCTAGAGGATCCCGCCACCATGAACTTTCTGCTGTCTTGG; (SEQ ID NO. 1)

[0040] VEGFA(4907-1)-P2: TCCTTGTAGTCCATACCCCGCCTCGGCTTGTCAC (SEQ ID NO. 2).

[0041] Table 1 reaction system

[0042] Reagent Volume (μL) wxya 2 o

32.5 5×PS Buffer 10 dNTP Mix (2.5mM each) 4 Upstream amplification primer (10μM) 1 Downstream amplification primer (10μM) 1 template 1 (10ng / μL)

1 PrimeSTAR HS DNA polymera...

Embodiment 2

[0047] Embodiment 2 self-made endotracheal tube

[0048] Take a 4.5F scalp needle, remove the extension tube, connect the front end of the needle core to the PE50 catheter, about 1.5-2.0 cm beyond the needle core; cut off the front end of the 1.9F central venous catheter core, and insert it into the scalp needle (the insertion depth is shorter than the front end of the PE50 catheter), On the one hand, the length of the tracheal tube is extended for easy operation; on the other hand, the hardness of the front end of the PE50 tube is increased to facilitate insertion into the trachea of ​​newborn rats. After the completion of the self-made tracheal tube, soak it in 75% alcohol for later use. figure 2 .

Embodiment 3

[0049] Embodiment 3 constructs rat model

[0050] 1. Set the parameters of the small animal ventilator: respiratory rate 90-100 times / min, tidal volume 4-6ml / kg, spare.

[0051] 2. Take 20-30 g of newborn rats for modeling, anesthetize them intraperitoneally with ketamine (100 mg / kg) and xylazine (10 mg / kg), and perform tracheal intubation after the anesthesia takes effect.

[0052] 3. Hang the front incisors of the newborn rats, and stick the back to the tripod to fix the newborn rats. The LED light faces the head and face of the newborn rats to irradiate the neck. Use a tracheal tube to measure the distance from the front incisors to the body surface of the larynx, and mark it .

[0053] 4. The operator faces the back of the newborn rat, and pulls out the tongue from the left corner of the rat’s left mouth with the left hand. A light spot about 2 mm in size can be seen in the middle of the throat, which can open and close with the breathing movement, which is the glottis T...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method of an animal model with high expression of genes transfected through an endotracheal pathway in lung tissues. The preparation method comprises the following steps: (1) constructing a recombinant virus vector carrying a vascular endothelial growth factor A, and adjusting a virus titer to 0.5 to 2x10<11>PFU / mL; and (2) anesthetizing an animal, hanging andfixing the animal, irradiating the neck of the animal, opening the oral cavity of the animal, inserting a tracheal catheter, injecting viruses into lung tissues of the animal through the tracheal catheter, connecting the animal with a breathing machine until the animal is awake, and finally pulling out the tracheal catheter. The invention constructs an animal model that achieves targeted transfection of a recombinant adenovirus vector in the lung tissue of newborn rats through an intratracheal route, the adenovirus vector is transfected into the trachea with a suitable amount of virus and theefficiency of transfection to other organs other than the lung is low, and transfection targeting is improved.

Description

technical field [0001] The invention belongs to the technical field of animal model preparation, and in particular relates to a method for preparing an animal model in which a gene transfected through an intratracheal route is highly expressed in lung tissue. Background technique [0002] Gene intervention technology is currently a popular technology in the basic research of clinical diseases. This technology can achieve the purpose of increasing or inhibiting the expression of target genes in tissues or cells through gene transfection, so as to further study the role of target genes in the pathogenesis of related diseases. is of great significance. Adenovirus vector is an important medium for gene intervention technology. The adenovirus shuttle plasmid carrying the target gene and the packaging plasmid carrying the adenovirus genome are co-transfected into HEK293 cells, and the recombinant adenovirus is produced through the action of the Cre / loxP recombinase system. And no...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/861C12N15/12A01K67/027A61D1/00A61D3/00A61D7/04
CPCC12N15/86C07K14/475A01K67/0278A61D1/00A61D3/00A61D7/04C12N2710/10343C12N2800/107A01K2207/15A01K2207/05A01K2227/105A01K2267/03
Inventor曹静李明霞王乐杨梅赵倩吴典
OwnerTHE FIRST TEACHING HOSPITAL OF XINJIANG MEDICAL UNIVERCITY