Application of combination of sulfhydryl oxidase 1 agonist and sorafenib in preparation of liver cancer treatment cells

A technology of hydrogen sulfhydryl oxidase and sulfhydryl oxidase, applied in gene therapy, oxidoreductase, application, etc., can solve problems such as incompletely clear biological functions

Pending Publication Date: 2021-01-08
ZHONGSHAN HOSPITAL FUDAN UNIV
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Existing technologies have confirmed that QSOX1 plays the role of a tumor suppressor gene in liver cancer, but its biological function in liver cancer cells is still not completely clear, and there is no application of QSOX1 agonists in combination with sorafenib to improve A report on the therapeutic effect of liver cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of combination of sulfhydryl oxidase 1 agonist and sorafenib in preparation of liver cancer treatment cells
  • Application of combination of sulfhydryl oxidase 1 agonist and sorafenib in preparation of liver cancer treatment cells
  • Application of combination of sulfhydryl oxidase 1 agonist and sorafenib in preparation of liver cancer treatment cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] The effect of QSOX1 agonist combined with sorafenib on the viability of liver cancer cells:

[0036] Experimental method: Overexpression vector construction

[0037] 1. Construct a lentivirus overexpressing QSOX1:

[0038] 1.1. The nucleotide sequence of the QSOX1 gene is shown in SEQ ID NO.1.

[0039] 1.2. Design QSOX1 gene amplification primers, the primer sequence is:

[0040] Upstream primer: TAGAGCTAGCGAATTCATGAGGAGGTGCAACAGC; SEQ ID NO.2;

[0041] Downstream primer: TCGCGGCCGCGGATCCTCAAATAAGCTCAGGTCCC; SEQ ID NO.3.

[0042] Wherein, the PCR reaction system for amplifying the QSOX1 gene is shown in Table 1:

[0043] Table 1 PCR reaction system

[0044] h 2 o

37.5μl 10×PCR Buffer 5μl 25mM MgCl 2

3μl 10mM dNTPs 1μl 10μM Forward or Reverse Primer 1 / 1μl MHCC97H strain cDNA 1μl Phusion 0.5μl Total 50μl

[0045] PCR amplification conditions: 98°C, 30s; 98°C, 10s, 55°C, 30s, 72°C, 30s, 40 cycle...

Embodiment 2

[0076] Effect of QSOX1 agonist combined with sorafenib on ferroptosis in liver cancer cells:

[0077] The above-mentioned human liver cancer cell lines MHCC97H [empty control group (MHCC97H-Vector) and QSOX1 overexpression group (MHCC97H-QSOX1)] were seeded in 6-well plates, 10 per well 5 cells. After sticking to the wall, it is divided into 4 groups, and each group has 3 auxiliary holes. Each group is as follows:

[0078] (1) Empty control group cells + DMSO;

[0079] (2) QSOX1 overexpression group cells + DMSO;

[0080] (3) Empty control group cells + 5 μM sorafenib (sorafenib);

[0081] (4) Cells in QSOX1 overexpression group + 5 μM sorafenib.

[0082] (A) For the detection of GSH content in the cells, after 24 hours of treatment, the supernatant was sucked off, and the GSH content in the cells of each group was detected with the GSH / GSSH detection kit (Biyuntian). Based on the results of the first group, the second group was calculated. -GSH relative content of 4 grou...

Embodiment 3

[0087] The effect of QSOX1 agonist combined with sorafenib on the size of orthotopic transplanted tumor of liver cancer cells:

[0088] The above-mentioned human liver cancer cell lines MHCC97H [empty control group (MHCC97H-Vector) and QSOX1 overexpression group (MHCC97H-QSOX1)] were placed in the 75cm 2 cultured in a culture flask to a sufficient density, digested with trypsin, and resuspended in PBS to contain 10 per 100 μl of PBS 7 cells. The above cell suspension was subcutaneously injected into the right axillary of each BALB / c nude mouse in an amount of 100 μl. After 2 weeks, the mice were killed, the subcutaneous tumor was taken out, and the tumor tissue was cut into 1mm with a scalpel 3 The cubes were placed in sterile saline for later use. Another BALB / c nude mouse used for orthotopic transplantation of liver cancer was taken and anesthetized by intraperitoneal injection of 80 μl of 2% pentobarbital. After the abdomen was disinfected, ophthalmology scissors were u...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides an application of a combination of a sulfhydryl oxidase 1 agonist and sorafenib in preparation of liver cancer treatment cells. The sulfhydryl oxidase 1 agonist comprises lentivirus for overexpression of sulfhydryl oxidase 1 and recombinant sulfhydryl oxidase 1 protein; firstly, lentivirus for overexpression of sulfhydryl oxidase 1 is constructed, and then target cells are transfected; and the dosage forms of the sulfhydryl oxidase 1 agonist comprise an oral preparation, an injection or a sustained release preparation and the like. The lentivirus for overexpression of QSOX1 and sorafenib are used for acting on liver cancer cells at the same time, QSOX1 can inhibit the activity of the liver cancer cells, the GSH content can be more obviously reduced, the free ferrousions in the cells and the lipid peroxidation level are increased, and thus cell ferroptosis is promoted; and therefore, the lentivirus for overexpression of QSOX1 is combined with sorafenib, so that the inhibition effect on tumor growth is promoted synergistically, and a stronger killing effect is achieved.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to the application of a hydrogen sulfhydryl oxidase 1 agonist combined with sorafenib in the preparation and treatment of liver cancer cells. Background technique [0002] Liver cancer ranks sixth among the new cases of malignant tumors in the world in 2018, and ranks fourth in the number of deaths. It is a dangerous malignant tumor of the digestive system. Although patients with early tumors, especially those with "small liver cancer", can obtain a better prognosis through surgical treatment, but because liver cancer often has an insidious onset, most of them are already in the middle and late stages when they are diagnosed, so patients lose the chance of radical surgery , and its natural course is about 3 to 6 months. For these patients, only palliative treatment and systemic chemotherapy can be performed, and the prognosis is extremely poor. [0003] Sorafenib is the fi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): A61K45/06A61K38/44A61K48/00A61K31/44A61P1/16A61P35/00C12N15/867C12N15/53
CPCA61K45/06A61K38/44A61K48/005A61K31/44A61P1/16A61P35/00C12N15/86C12N9/0051C12Y108/03002C12N2740/15043C12N2800/107
Inventor 孙嘉磊周海军
Owner ZHONGSHAN HOSPITAL FUDAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap