Application of combination of sulfhydryl oxidase 1 agonist and sorafenib in preparation of liver cancer treatment cells
A technology of hydrogen sulfhydryl oxidase and sulfhydryl oxidase, applied in gene therapy, oxidoreductase, application, etc., can solve problems such as incompletely clear biological functions
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] The effect of QSOX1 agonist combined with sorafenib on the viability of liver cancer cells:
[0036] Experimental method: Overexpression vector construction
[0037] 1. Construct a lentivirus overexpressing QSOX1:
[0038] 1.1. The nucleotide sequence of the QSOX1 gene is shown in SEQ ID NO.1.
[0039] 1.2. Design QSOX1 gene amplification primers, the primer sequence is:
[0040] Upstream primer: TAGAGCTAGCGAATTCATGAGGAGGTGCAACAGC; SEQ ID NO.2;
[0041] Downstream primer: TCGCGGCCGCGGATCCTCAAATAAGCTCAGGTCCC; SEQ ID NO.3.
[0042] Wherein, the PCR reaction system for amplifying the QSOX1 gene is shown in Table 1:
[0043] Table 1 PCR reaction system
[0044] h 2 o
37.5μl 10×PCR Buffer 5μl 25mM MgCl 2
3μl 10mM dNTPs 1μl 10μM Forward or Reverse Primer 1 / 1μl MHCC97H strain cDNA 1μl Phusion 0.5μl Total 50μl
[0045] PCR amplification conditions: 98°C, 30s; 98°C, 10s, 55°C, 30s, 72°C, 30s, 40 cycle...
Embodiment 2
[0076] Effect of QSOX1 agonist combined with sorafenib on ferroptosis in liver cancer cells:
[0077] The above-mentioned human liver cancer cell lines MHCC97H [empty control group (MHCC97H-Vector) and QSOX1 overexpression group (MHCC97H-QSOX1)] were seeded in 6-well plates, 10 per well 5 cells. After sticking to the wall, it is divided into 4 groups, and each group has 3 auxiliary holes. Each group is as follows:
[0078] (1) Empty control group cells + DMSO;
[0079] (2) QSOX1 overexpression group cells + DMSO;
[0080] (3) Empty control group cells + 5 μM sorafenib (sorafenib);
[0081] (4) Cells in QSOX1 overexpression group + 5 μM sorafenib.
[0082] (A) For the detection of GSH content in the cells, after 24 hours of treatment, the supernatant was sucked off, and the GSH content in the cells of each group was detected with the GSH / GSSH detection kit (Biyuntian). Based on the results of the first group, the second group was calculated. -GSH relative content of 4 grou...
Embodiment 3
[0087] The effect of QSOX1 agonist combined with sorafenib on the size of orthotopic transplanted tumor of liver cancer cells:
[0088] The above-mentioned human liver cancer cell lines MHCC97H [empty control group (MHCC97H-Vector) and QSOX1 overexpression group (MHCC97H-QSOX1)] were placed in the 75cm 2 cultured in a culture flask to a sufficient density, digested with trypsin, and resuspended in PBS to contain 10 per 100 μl of PBS 7 cells. The above cell suspension was subcutaneously injected into the right axillary of each BALB / c nude mouse in an amount of 100 μl. After 2 weeks, the mice were killed, the subcutaneous tumor was taken out, and the tumor tissue was cut into 1mm with a scalpel 3 The cubes were placed in sterile saline for later use. Another BALB / c nude mouse used for orthotopic transplantation of liver cancer was taken and anesthetized by intraperitoneal injection of 80 μl of 2% pentobarbital. After the abdomen was disinfected, ophthalmology scissors were u...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


