Supercharge Your Innovation With Domain-Expert AI Agents!

Sequence combination for gradient regulation on starting efficiency of bacillus promoter and application

A technology of Bacillus and Bacillus licheniformis, which is applied in the field of genetic engineering and microbial protein expression, can solve the problems of lack of precise regulation of gene expression and restriction of efficient expression of Bacillus licheniformis protein

Active Publication Date: 2021-01-15
HUBEI UNIV
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, it still lacks effective tools for precise regulation of gene expression, which greatly limits the establishment of a metabolic engineering breeding platform for efficient expression of B. licheniformis proteins and high yields of target products.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sequence combination for gradient regulation on starting efficiency of bacillus promoter and application
  • Sequence combination for gradient regulation on starting efficiency of bacillus promoter and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Obtaining sequence combinations for gradient regulation of the efficiency of Bacillus promoters:

[0018] The invention takes the bacitracin synthesis gene cluster promoter PbacA of bacillus licheniformis DW2 as the research object. First, based on the Bacillus licheniformis DW2 transcriptome data, and taking into account the secondary structure of the 5'UTR, SD sequence characteristics and position and other factors, screen the 5'UTR of different promoters; then replace the 5'UTR of PbacA; then, In different Bacillus hosts, the universality of different proteins was verified; finally, the present invention obtained a set of sequence combinations that gradiently regulate the efficiency of Bacillus promoters, as follows:

[0019] GAAACAACAAAGGGGGAGATTTGT (shown in SEQ ID NO.1);

[0020] ATTTTATCAAAAAGGAGAATTTTTAT (shown in SEQ ID NO.2);

[0021] CATTCAGAATAAGGACGGAGGATTCACG (shown in SEQ ID NO.3);

[0022] By replacing the above sequence with the 5'UTR of the target p...

Embodiment 2

[0032] Application of sequence combinations for gradient regulation of the efficiency of Bacillus promoters:

[0033] To ensure that the PbacA promoter core region of Bacillus licheniformis DW2 remains unchanged, the following sequence combinations are respectively replaced by the 5'UTR of the PbacA promoter in Bacillus licheniformis DW2, and the sequence combination is:

[0034] GAAACAACAAAGGGGGAGATTTGT (shown in SEQ ID NO.1);

[0035] ATTTTATCAAAAAGGAGAATTTTTAT (shown in SEQ ID NO.2);

[0036] CATTCAGAATAAGGACGGAGGATTCACG (shown in SEQ ID NO.3);

[0037] The replaced promoters are respectively named PUbay, PbacA and PUndh, and the corresponding nucleotide sequences are respectively shown in SEQ ID NO.4-SEQ ID NO.6.

[0038] Table 1 Design of expression vector primers for gradient promoters

[0039]

[0040]

[0041] Note: The underline is the homology arm region, 18-20bp.

[0042] 1. Using the plasmid pHY-P43-GFP (DOI: 10.1016 / j.jbiotec.2020.02.015) preserved in ou...

Embodiment 3

[0082] The application of gradient promoter to regulate the expression level of green fluorescent protein in Bacillus amyloliquefaciens:

[0083] 1. Transfer the plasmids pHY-PUbay-GFP, pHY-PbacA-GFP, and pHY-PUndh-GFP into Bacillus amyloliquefaciens HZ-12, use tetracyclic antibiotics as selection markers, and then obtain positive transformants by colony PCR screening , so as to obtain gradient promoter-mediated GFP engineering bacteria HZ-12 / PUbay-GFP, HZ-12 / PbacA-GFP, HZ-12 / PUndh-GFP;

[0084] 2. Similarly, transfer the plasmids pHY-PUtyrA-GFP, pHY-PUcspB-GFP, pHY-PUgapA-GFP into Bacillus amyloliquefaciens HZ-12 to obtain the engineering strain HZ-12 / PUtyrA-GFP, HZ-12 / PUcspB-GFP, HZ-12 / PUgapA-GFP.

[0085] 3. According to steps 8-10 of Example 1, it was found that: in Bacillus amyloliquefaciens HZ-12, the GFP fluorescence intensity expressed by the promoters PUba y, PbacA, and PUndh provided by the present invention was 23.77×10 5 , 3.52×10 5 , 1.16×10 5 , indicating th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of genetic engineering and microbial protein expression, and discloses a sequence combination for gradient regulation on the starting efficiency of bacillus promoterand application. On the basis of a gene cluster promoter PbacA synthesized from a bacillus licheniformis DW2 bacitracin, the 5'UTR of promoters PylB and Pndh are used for replacing 5'UTR of the PbacArespectively so as to obtain a group of strong, neutral and weak promoters (PUbay, PbacA and PUndh) for bacillus. Then, green fluorescent protein GFP, red fluorescent protein GFP and keratinase KER are used as target proteins, and different proteins can be expressed in different bacillus (bacillus licheniformis DW2, bacillus amyloliquefaciens HZ-12 and bacillus subtilis 168) at different expression levels through gradient promoters PUndh (weak), PbacA (medium) and PUbay (strong) respectively.

Description

technical field [0001] The invention relates to the fields of genetic engineering and microbial protein expression, in particular to sequence combinations and applications for gradiently regulating the starting efficiency of bacillus promoters. Background technique [0002] The promoter is a special DNA sequence located upstream of the gene transcription unit, which has the function of initiating gene transcription and plays an important role in regulating the level of gene transcription. With the development of synthetic biology and metabolic pathway engineering, people have gradually found that in order to achieve high yields of target products, it is crucial to balance the metabolic flux of the growth and production of engineered strains, so as to develop precise regulation of protein expression levels and metabolite metabolism. The tools of the pathway have become a research hotspot. Since the promoter is the switch of gene transcription, it is identified as the preferr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/75
CPCC07K14/32C12N15/75
Inventor 陈守文饶忆蔡冬波马昕
Owner HUBEI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com