Unlock instant, AI-driven research and patent intelligence for your innovation.

Primer group and kit for detecting drug resistance genes of streptococcus suis based on multiple PCR-DHPLC and application of primer group and kit

A technique of PCR-DHPLC and Streptococcus suis, which is applied in the field of primer sets and kits for detecting drug-resistant genes of Streptococcus suis, can solve the problems of cumbersome operation and low detection sensitivity, and achieve simple result analysis, high sensitivity, and guaranteed The effect of accuracy

Pending Publication Date: 2021-03-02
SHANGHAI ANIMAL EPIDEMIC PREVENTION & CONTROL CENT
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the resistance genes of Streptococcus suis to macrolide antibiotics include ermA / B / C, mefA, msrD, mphB, 23S rRNA, L4, L22, etc. The detection of the above resistance genes usually uses PCR detection method for a single gene , when detecting multiple drug resistance genes, multiple PCR tests are required, the operation is cumbersome and the detection sensitivity is low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer group and kit for detecting drug resistance genes of streptococcus suis based on multiple PCR-DHPLC and application of primer group and kit
  • Primer group and kit for detecting drug resistance genes of streptococcus suis based on multiple PCR-DHPLC and application of primer group and kit
  • Primer group and kit for detecting drug resistance genes of streptococcus suis based on multiple PCR-DHPLC and application of primer group and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] The Streptococcus suis strains used were all from the Streptococcus suis isolated, identified and preserved in our center from 1998 to 2017. The identification genes include Streptococcus suis 16s rRNA and glutamate dehydrogenase genes. Double PCR detection of 16srRNA and glutamate dehydrogenase gene was carried out by PCR method. The PCR reaction system is 25 μL: 12.5 μL of 2×premix, 0.5 μL of upstream and downstream of two pairs of primers, 2 μL of DNA template, and 8.5 μL of sterilized distilled water. The PCR reaction conditions were: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 1 min, and 30 cycles of amplification; extension at 72°C for 10 min. The nucleotide sequence information of the two pairs of primers is shown in Table 1.

[0069] Table 1 List of primers for 16s rRNA and glutamate dehydrogenase gene amplification of Streptococcus suis

[0070]

[0071]

[0072] The PCR amplifica...

Embodiment 2

[0079] Select 91 bacterial strains from Table 2 of Example 1 as the clinically verified bacterial strains of Streptococcus suis resistant to macrolide drug-resistant gene mPCR-DHPLC detection technology, and the specifically selected strains are Nos. 1 to 90 in Table 2 and number 96.

[0080] In order to verify the primer amplification situation of ermA gene gene, carry out following experiment:

[0081]The ermA gene sequence (SEQ ID No.13) of Streptococcus suis strain 36a / Genbank accession number EU348757.1 was used as a template, and primers were designed to obtain ermA-F tctaaaaagcatgtaaaagaa (SEQ ID No.1), ermA-Rcttcgatagttttattaatattagt (SEQ ID No.2).

[0082] Using the strains in Table 2 as raw materials, extract the genomic DNA of Streptococcus suis, use the genomic DNA as a template, and use ermA-F and ermA-R as primers to carry out PCR amplification reaction. The amplification procedure of PCR amplification is as follows: 94 5min at ℃; 35 cycles of 94℃ for 30s, 55℃ ...

Embodiment 3

[0089] In order to verify the primer amplification of a single gene, the following experiments were performed

[0090] 猪链球菌Streptococcus suis BM407 / Genbank登录号FM252032.1(atgaacaaaaatataaaatattctcaaaactttttaacgagtgaaaaagtactcaaccaaataataaaacaattgaatttaaaagaaaccgataccgtttacgaaattggaacaggtaaagggcatttaacgacgaaactggctaaaataagtaaacaggtaacgtctattgaattagacagtcatctattcaacttatcgtcagaaaaattaaaactgaatactcgtgtcactttaattcaccaagatattctacagtttcaattccctaacaaacagaggtataaaattgttgggaatattccttaccatttaagcacacaaattattaaaaaagtggtttttgaaagccatgcgtctgacatctatctgattgttgaagaaggattctacaagcgtaccttggatattcaccgaacactagggttgctcttgcacactcaagtctcgattcagcaattgcttaagctgccagcggaatgctttcatcctaaaccaaaagtaaacagtgtcttaataaaacttacccgccataccacagatgttccagataaatattggaagctatatacgtactttgtttcaaaatgggtcaatcgagaatatcgtcaactgtttactaaaaatcagtttcatcaagcaatgaaacacgccaaagtaaacaatttaagtaccgttacttatgagcaagtattgtctatttttaatagttatctattatttaacggga ggaaataa,SEQ ID No.14)为模板,设计引物,得到ermB-F(gaaaaggatctcaaccaaata,SEQ ID No.3),ermB-F(agtaacggtact...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a primer group and kit for detecting drug resistance genes of streptococcus suis based on multiple PCR-DHPLC and an application of the primer group and the kit, and belongs to the technical field of veterinary clinical detection. The primer group for detecting the drug resistance gene of streptococcus suis based on multiple PCR-DHPLC comprises a primer pair for amplifying anermA gene, an ermB gene, a mefA gene and an msrD gene. The primer group provided by the invention has relatively strong specificity and can be used for PCR amplification and DHPLC analysis. The application of the primer group or the kit in streptococcus suis drug resistance gene detection aims at detection of four pairs of drug resistance genes of streptococcus suis macrolide-resistant drugs, candetect four target genes at the same time, meets the requirements of a rapid high-throughput technology, and is good in detection specificity, high in sensitivity and high in sensitivity. The kit canbe used for clinically detecting drug-resistant genes of four macrolide-resistant drugs, namely ermA, ermB, mefA and msrD, of streptococcus suis.

Description

technical field [0001] The invention belongs to the technical field of veterinary clinical detection, and in particular relates to a primer set and a kit for detecting drug-resistant genes of Streptococcus suis based on multiplex PCR-DHPLC and applications thereof. Background technique [0002] Streptococcus suis is a Gram-positive coccus with a capsule. The colonization site of Streptococcus suis is the upper respiratory tract of pigs, especially the tonsils and nasal cavity. Some serotypes of Streptococcus suis are pathogenic and mainly infected through wounds. It can cause acute sepsis (septicemia with sudden death), meningitis (meningitis), arthritis (arthritis), endocarditis (endocarditis), pneumonia (pneumonia) and other diseases in pigs. Some strains can cause human infection, causing bacterial meningitis or toxic shock-like syndrome. [0003] Streptococcus suis infection can generally be preliminarily diagnosed based on clinical symptoms and changes in pathologica...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/689C12Q1/686C12Q1/14C12N15/11
CPCC12Q1/689C12Q1/686C12Q2600/16C12Q2537/143C12Q2565/137C12Q2563/107
Inventor 王晓旭徐锋王建赵洪进沈莉萍齐新永宁昆葛杰
Owner SHANGHAI ANIMAL EPIDEMIC PREVENTION & CONTROL CENT