Chitin deacetylase and encoding gene thereof, recombinant vector, recombinant strain, leavening agent and enzyme preparation, and application of chitin deacetylase and encoding gene thereof, recombinant vector, recombinant strain, leavening agent and enzyme preparation
A technology of deacetylase and recombinant strains, applied in fermentation, application, genetic engineering, etc., can solve the problems of less bacterial sources, high catalytic temperature, low enzyme production activity, etc., to save energy and auxiliary materials and other costs, and high catalytic activity , the effect of broad application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0067] A sixth aspect of the present invention provides a method for preparing chitin deacetylase, the method comprising: inoculating the above-mentioned recombinant strain and / or the above-mentioned starter into a fermentation medium for fermentation, and performing fermentation on the fermentation product. It is separated and purified to obtain chitin deacetylase.
[0068] The method for preparing chitin deacetylase provided by the present invention includes: culturing the recombinant strain provided by the present invention, inducing the expression of a gene encoding chitin deacetylase; isolating and purifying the expressed chitin deacetylase.
[0069] Wherein, the culturing conditions are conventional culturing conditions, such as using LB medium (the solvent is water, the solute and its final concentration are respectively: tryptone 5-15g / L, yeast extract 1-10g / L, NaCl 5-15g / L), cultured at 35-37°C.
[0070]Since the recombinant strain provided by the present invention ...
Embodiment 1
[0084] This example is used to illustrate the acquisition of the target gene bli.
[0085] Shanghai Sangon Bioengineering Co., Ltd. was entrusted to synthesize the gene sequence shown in SEQ ID NO.1 and the primer sequences shown in SEQ ID NO.9 and SEQ ID NO.10. Wherein, SEQ ID NO.9: GCG GGATCC GTGAACCATTTTTATGTGTG; SEQ ID NO. 10: GCG ACGCGT CTACTTTACTTCTGAAGATT. BamH I and Mlu I restriction endonuclease sites were introduced into the upstream and downstream primers, respectively.
[0086] PCR amplification was performed using the synthetic DNA as a template. PCR reaction system: Premix (25μl), ddH 2 O (22 μl), upstream and downstream primers (1 μl each), DNA template (1 μl). The reaction conditions were: 94°C for 5 min, 1 cycle; 94°C for 30 s, 55°C for 30 s, 72°C for 1 min, 30 cycles; 72°C for 10 min, 1 cycle. PCR products were analyzed by agarose gel electrophoresis ( figure 1 ), cut the gel to recover the target fragment.
[0087] The target fragment was ligated i...
Embodiment 2
[0092] This example is used to illustrate the acquisition of B122 / pMA5-bli genetically engineered strain of Bacillus licheniformis.
[0093] Double enzyme digestion of target gene
[0094] The target gene obtained in Example 1 was excised from the cloning vector. The digestion reaction system is: vector pMD-19T-bli (5μl), restriction enzyme BamH I (1μl), restriction enzyme Mlu I (1μl), 10*Buffer (1μl), ddH 2 O (2 μl); reaction conditions: 37° C., 2 h. After the digestion product was analyzed by 1% agarose gel electrophoresis, the target gene fragment was recovered by cutting the gel.
[0095] Expression vector double digestion
[0096] Double digestion of the expression vector. The digestion reaction system is: vector pMA5 (5 μl), restriction endonuclease BamH I (1 μl), restriction endonuclease Mlu I (1 μl), 10*Buffer (1 μl), ddH 2 O (2 μl); reaction conditions: 37° C., 2 h. After the digestion product was analyzed by 1% agarose gel electrophoresis, the target gene fragm...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More