A root-knot nematode related miRNA and its regulatory gene, protein and application
A root-knot nematode disease and gene regulation technology, applied in the direction of DNA / RNA fragments, applications, genetic engineering, etc., to achieve safe and sustainable control, reduce agricultural input, and reduce application effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0076] Example 1 PCR amplification of miRNA miRcn1 gene and construction of pEarleyGate202+miRcn1 recombinant vector
[0077] 1.1 Design primers
[0078] Using miRcn1 mature sequence SEQ ID NO.1 (taacttcgtctagctcgccttc) and RPS300 plasmid, using the software WMD3 (http: / / wmd3.weigelworld.org / cgi-bin / webapp.cgi) to design primers, a total of 4 primer sequences were generated, The sequences were named as I miRcn1-s, II miRcn1-a and III miRcn1*s, IV miRcn1*a respectively, and were numbered as SEQ ID NO.2-SEQ ID NO.5.
[0079] SEQ ID NO.2 (I miRcn1-s):
[0080] ga taacttcgtctagctcgccttc tctctcttttgtattcc
[0081] SEQ ID NO.3 (II miRcn1-a):
[0082] ga gaaggcgagctagacgaagtta tcaaagagaatcaatga
[0083] SEQ ID NO.4 (III miRcn1*s):
[0084] ga gacggcgagctagtcgaagtta tcacaggtcgtgatatg
[0085] SEQ ID NO.5 (IV miRcn1*a):
[0086] ga taacttcgactagctcgccgtc tctacatatatattcct
[0087] Among them, the underlined part is the mature sequence of miRcn1 to obtain the complementa...
Embodiment 2
[0098] Example 2 PCR amplification of CRF9 and construction of pEarleyGate202+CRF9 recombinant vector
[0099] The genome sequence SEQ ID NO.10 of tomato (Solanum lycopersicum) Moneymaker cDNA was used as a template. Using SEQ ID NO.8 and SEQ ID NO.9 as primers, the high-fidelity enzyme Phanta Max Super-FidelityDNA Polymerase (Novizyme, Nanjing, China) was used to amplify the gene CRF9. The sequence number of the amplified product CRF9 is SEQ ID NO.10.
[0100] SEQ ID NO.8: 5'-ccggaattcatggatggttgcattagttc-3'
[0101] SEQ ID NO.9: 5'-cgcggatccttataccaaaactgcatcta-3'
[0102] SEQ ID NO.10:
[0103] atggatggttgcattagttcagtgaggaaagttcgcatagtttatgatgatcctgatgctacgga ctctgagagcgatgatgatcagaatgctgctcgtttcgataaaaatgtgaacagaatcaagcgtg ttgttaaggaaattgttattcctgttgtttcatgggagaatgattttaaaaaatgttctaaactt gataacattaggattaaagattccaagaagattcatgaaaataagaaggtgcagctaaaatcgac cgcgttgcctaaaggagttaggatgaggaaatgggggaaatatgcagctgagatcagagatccct cgcaggggaaaagaatatggttagggacttttgagactgtggaggcggcttca...
Embodiment 3
[0107] Example 3 Recombinant Agrobacterium tumefaciens GV3101+CRF9 and recombinant Agrobacterium tumefaciens GV3101+miRNA miRcn1
[0108] 3.1. Preparation of Agrobacterium tumefaciens GV3101 Competent Cells
[0109] Activate GV3101 on solid medium plate of LB [50mg / l rifampicin (Rif)], 1-2d. A single colony GV3101 was picked and inoculated in 5ml LB (50mg / l Rif) liquid medium at 28°C, 200 rpm, overnight. Take 2ml of the culture into 50ml of LB liquid medium, at 28°C, 200rpm, and continue to cultivate until the OD600 is about 0.5. Place the culture on ice, ice-bath for 30min, centrifuge at 5000rpm at 4°C for 5min, and discard the supernatant. Suspend the cells with 10 ml of refrigerated 0.1 mol / l NaCl; centrifuge at 5000 rpm for 5 min at 4°C, and discard the supernatant. Suspend with 1ml of refrigerated 20mmol / l CaCl2, aliquot into 50uL / tube (final concentration of glycerol is 20%), and store at -80°C after quick freezing in liquid nitrogen.
[0110] 3.2. Transformation of ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com