Check patentability & draft patents in minutes with Patsnap Eureka AI!

Novel long noncoding RNA gene and application thereof to preparation of reagent for detecting or diagnosing early melanosis

A long-chain non-coding, melanosis technology, applied in the biological field, can solve problems such as the unclear pathogenesis of human melanosis, and achieve the effects of difficult detection, wide application range, and small content of detection objects

Pending Publication Date: 2021-03-26
CHONGQING ACAD OF ANIMAL SCI
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the pathogenesis of human melanosis is still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel long noncoding RNA gene and application thereof to preparation of reagent for detecting or diagnosing early melanosis
  • Novel long noncoding RNA gene and application thereof to preparation of reagent for detecting or diagnosing early melanosis
  • Novel long noncoding RNA gene and application thereof to preparation of reagent for detecting or diagnosing early melanosis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] A long-chain non-coding RNA, the sequence of which is shown in SEQ ID NO.1.

[0029] 1 Tissue expression characteristics of LncRNATCONS_00153149

[0030] 1.1 Expression characteristics of LncRNATCONS_00153149 in various tissues of Youzhou black sheep

[0031] The results of real-time quantitative PCR (qPCR) analysis showed that the relative expression of lncRNA TCONS_00153149 gene in spleen was the highest, which was significantly higher than that in skin, kidney, lung, liver and heart tissues (P﹤0.01), and the relative expression of lncRNA TCONS_00153149 gene in skin There was no significant difference between the expression level and the relative expression level in muscle, brain, skin, kidney, lung, liver and heart tissues (P>0.05)( figure 1 ).

[0032] 1.2 Expression difference of LncRNA TCONS_00153149 among goat breeds with different skin colors

[0033] qPCR was used to detect the expression of lncRNA TCONS_00153149 in the tissues of Youzhou black sheep (Wupi)...

Embodiment 2

[0043] Example 2 Detection of hyperplasia of melanin in fetal early skin tissue

[0044] When goat fetuses of different coat colors develop to 100 days old, their hair has not yet been produced. Detecting the expression of key genes for skin melanin production in 100-day-old fetuses of black goats and white goats can clarify the status of melanin hyperplasia in skin tissue at this time. The early symptoms of all human melanosis are abnormal hyperplasia of melanin. Therefore, the study of the relationship between early goat fetal melanoma hyperplasia and TCONS_00153149 can also provide an important reference for the clinical diagnosis of human melanoma hyperplasia.

[0045] Reagent: a kit for detecting early melanoma, including: a pair of specific primers (18OD) for amplification of lncRNA TCONS_00153149, polymerase solution (10ml), dye (1ml), RNase ddH2O (50ml);

[0046] The primer sequence is: F:CTGCACCTTGGACCTGTGAC

[0047] R: CCTATTCTCTGCGTCCTCCTG

[0048] The reaction ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention also provides a novel long noncoding RNA gene, and the sequence of the novel long noncoding RNA gene is shown as SEQ ID NO.1. The invention also provides an application of the novel longnoncoding RNA gene to preparation of a reagent for detecting or diagnosing early melanosis, and also provides tissue expression characteristics, melanogenesis promoting effect and action mechanism ofthe new gene, thereby providing a theoretical basis for development of clinical medicines for treating melanosis in the next step. The novel long noncoding RNA provided by the invention can be used for early clinical detection of various melanosis diseases so as to facilitate early intervention of diseases, is not limited to melanoma, can also be used for early clinical detection and prevention of various melanosis diseases with tissue melanin hyperplasia, and is wider in application range.

Description

technical field [0001] The invention belongs to the field of biology, and in particular relates to a long-chain non-coding RNA and its application. Background technique [0002] Long noncoding RNA (long noncoding RNA, lncRNA) is a class of transcripts longer than 200 nucleotides that cannot encode proteins, and is mainly involved in the regulation of gene expression. Studies have shown that it can participate in many important regulatory processes such as X chromosome inactivation and transcription, chromatin modification, genome imprinting, interfering with gene promoters, inducing histone modification, protein activity regulation, and nuclear transport. Gene regulation, signal pathways, transcriptional and post-transcriptional regulation of protein-coding gene expression are involved in gene expression and regulation. At present, it has been confirmed that the occurrence and development of various diseases, the transformation, invasion and metastasis of different tumor ce...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12Q1/6886C12Q1/6883
CPCC12Q1/6886C12Q1/6883C12Q2600/158C12Q2600/178
Inventor 任航行张丽王高富蒋婧董贤文李杰孙晓燕付琳周鹏刘良佳
Owner CHONGQING ACAD OF ANIMAL SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More