Novel long noncoding RNA gene and application thereof to preparation of reagent for detecting or diagnosing early melanosis
A long-chain non-coding, melanosis technology, applied in the biological field, can solve problems such as the unclear pathogenesis of human melanosis, and achieve the effects of difficult detection, wide application range, and small content of detection objects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] A long-chain non-coding RNA, the sequence of which is shown in SEQ ID NO.1.
[0029] 1 Tissue expression characteristics of LncRNATCONS_00153149
[0030] 1.1 Expression characteristics of LncRNATCONS_00153149 in various tissues of Youzhou black sheep
[0031] The results of real-time quantitative PCR (qPCR) analysis showed that the relative expression of lncRNA TCONS_00153149 gene in spleen was the highest, which was significantly higher than that in skin, kidney, lung, liver and heart tissues (P﹤0.01), and the relative expression of lncRNA TCONS_00153149 gene in skin There was no significant difference between the expression level and the relative expression level in muscle, brain, skin, kidney, lung, liver and heart tissues (P>0.05)( figure 1 ).
[0032] 1.2 Expression difference of LncRNA TCONS_00153149 among goat breeds with different skin colors
[0033] qPCR was used to detect the expression of lncRNA TCONS_00153149 in the tissues of Youzhou black sheep (Wupi)...
Embodiment 2
[0043] Example 2 Detection of hyperplasia of melanin in fetal early skin tissue
[0044] When goat fetuses of different coat colors develop to 100 days old, their hair has not yet been produced. Detecting the expression of key genes for skin melanin production in 100-day-old fetuses of black goats and white goats can clarify the status of melanin hyperplasia in skin tissue at this time. The early symptoms of all human melanosis are abnormal hyperplasia of melanin. Therefore, the study of the relationship between early goat fetal melanoma hyperplasia and TCONS_00153149 can also provide an important reference for the clinical diagnosis of human melanoma hyperplasia.
[0045] Reagent: a kit for detecting early melanoma, including: a pair of specific primers (18OD) for amplification of lncRNA TCONS_00153149, polymerase solution (10ml), dye (1ml), RNase ddH2O (50ml);
[0046] The primer sequence is: F:CTGCACCTTGGACCTGTGAC
[0047] R: CCTATTCTCTGCGTCCTCCTG
[0048] The reaction ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com