Alleles related to self-cross-compatibility characters of non-heading Chinese cabbages and obtained through gene editing and application of alleles

An allele and gene editing technology, applied in the field of genetic engineering, can solve the problems of self-incompatibility reaction, affecting the reproduction of breeding materials and seed production, and the low self-seed rate of non-heading Chinese cabbage, so as to reduce the seed production Cost, the effect of improving breeding efficiency

Active Publication Date: 2021-03-30
WUHAN ACADEMY OF AGRI SCI
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Previous studies on the rapeseed line 'Westar' found that the stigma recognition gene BnSRK1 on its A genome has a complete function and can recognize the BrSP11-47 gene from cabbage pollen, leading to self-incompatibility reactions
Due to the influence of self-incompatibility, the self-seed setting rate of non-heading Chinese cabbage is very low, which seriously affects the reproduction and seed production of breeding materials

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Alleles related to self-cross-compatibility characters of non-heading Chinese cabbages and obtained through gene editing and application of alleles
  • Alleles related to self-cross-compatibility characters of non-heading Chinese cabbages and obtained through gene editing and application of alleles
  • Alleles related to self-cross-compatibility characters of non-heading Chinese cabbages and obtained through gene editing and application of alleles

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Site-directed editing of the self-incompatibility gene BnSRK1

[0027] Target site design was performed according to the published sequence of the BnSRK1 gene (NCBI database sequence number AB270771). The BnSRK1 gene has 7 exons and 6 introns, and the total sequence length is 3851bp; according to the structural information of the BnSRK1 gene, using the CRISPR-P (http: / / crispr.hzau.edu.cn / CRISPR2 / ) website, in its Two target sites were designed in the exon 1 region, see Table 1. The target site fragment was amplified by PCR, and the primers used were listed in Table 2. The amplified fragment was recombined with the gene editing expression vector PKSE401 (purchased from Wuhan Tianwen Biotechnology Co., Ltd.), and then electrotransformed into Escherichia coli DH5α, and the clones were selected and shaken. , and select positive clones to send samples for detection, and relevant primers for detection are shown in Table 3. For specific vector construction steps, p...

Embodiment 2

[0036] Embodiment 2 Transformation of mutant allele BnSRK1m

[0037] 1. Parent, hybrid F 1 Genotyping and molecular marker development

[0038] F 1 generation seeds. Self-incompatibility gene universal primers IISP11-1L / IISP11-1R (primer series IISP11-1L: TCATAAGTCATGAGATATGCTACTT, SEQ ID No.17; IISP11-1R: TTATGATTTAACTTTGCAACAGTAGC, SEQ ID No.18) are not self-fertile to male parent. The affinity line 'QR44' was amplified, and the PCR product was cloned, sequenced, and compared. The results showed that it contained a class II self-incompatibility gene, and the genotype was class II SP11-44, which was similar to the gene in transgenic rapeseed. Self-incompatibility genes are quite different.

[0039] At the same time, a specific molecular marker mSRK1-L / SRK1-CO-R was developed according to the sequence of the mutant allele BnSRK1m (primer sequence mSRK1-L: GATAACCCTCTCCCCAATTGGA, SEQ ID No.19; SRK1-CO-R: ATCACGAAGTTTCCATTAGCGA, SEQ ID No.20), the product size is 141bp ( ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of gene engineering, in particular to alleles related to self-cross-compatibility characters of non-heading Chinese cabbages and obtained through gene editing and application of alleles. The nucleotide sequence of the allele provided by the invention is as shown in SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3 or SEQ ID No. 4. The invention further providesa molecular marker of the allele, and applications of the allele and the molecular marker. The self-compatible non-heading Chinese cabbage material is successfully obtained through the technical meansof gene editing, distant hybridization, continuous backcross, molecular marker-assisted selection and the like. Therefore, the self-incompatibility of the non-heading Chinese cabbages is broken through, and the self-compatible material created by the method can greatly improve the breeding efficiency and reduce the seed production cost.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to an allele related to the self-compatibility trait of non-heading Chinese cabbage obtained through gene editing and its application. Background technique [0002] Self-incompatibility (SI) in plants refers to the phenomenon that the pistil stigma can recognize its own pollen, so that its own pollen cannot germinate or elongate, resulting in the failure of normal pollination or normal pollination. Self-incompatibility is widely distributed in cruciferous vegetable crops (cabbage, cabbage, radish, broccoli, etc.), and is genetically controlled by multiple alleles at the S site. The S locus mainly includes two key recognition genes: SRK, which controls the recognition specificity of stigma; SP11 / SCR, which controls the recognition specificity of pollen. When the pollen falls on its own stigma, the pollen SP11 / SCR protein recognizes the stigma SRK protein, causing the aut...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C12N15/11C12N15/82C12Q1/6895C12Q1/6809A01H1/02A01H1/04A01H5/00A01H6/20
CPCA01H1/02A01H1/04C07K14/415C12N15/8218C12N15/8261C12Q1/6809C12Q1/6895C12Q2600/13C12Q2600/156C12Q2531/113C12Q2535/122
Inventor高长斌汪爱华张雪丽宋莉萍林处发
OwnerWUHAN ACADEMY OF AGRI SCI