Targeting capture probe of tumor fusion gene and application thereof

A fusion gene and targeted capture technology, which is applied in the determination/testing of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problem of not being able to clarify the detailed break site of the gene, and not publishing the principle of probe design and probe sequence , No fusion gene detection and other problems have been found, which is conducive to remote inspection, fast detection time, and improved detection sensitivity

Pending Publication Date: 2021-04-16
THE FIRST AFFILIATED HOSPITAL OF SOOCHOW UNIV
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

4. The principle of Fluorescence in situ hybridization (FISH) is to design different fluorescently labeled probes for the target gene. Although it can also detect whether the target gene is fused through fluorescence microscope observation, it cannot clarify the detailed break site of the target gene.
The probe design is based on the exon DNA sequence where the genome gene is located, but the article did not publish the probe design principle and probe sequence
[0005] At present, there is no probe design based on the gene transcript number sequence at home and abroad and it is applied to the transcript level targeted capture sequencing, let alone the detection of BCR, ABL1, RUNX1, CBFB, PML, RARA and KMT2A fusion genes at the transcriptome level

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Targeting capture probe of tumor fusion gene and application thereof
  • Targeting capture probe of tumor fusion gene and application thereof
  • Targeting capture probe of tumor fusion gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0093] Taking the probe sequence SEQ ID NO: 312 of exon 2 of the RARA gene exon: CGGTGCCTCCCTACGCCTTCTTCTTCCCCCCTATGCTGGGTGGACTCTCCCCGCCAGG CGCTCTGACCACTCTCCAGCACCAGCTTCCAGTTAGTGGATATAGCACACCATCCCCA GCCA as an example, after comparing the sequences to the human transcription probe database at http: / / grch37.ensembl.org / Multi / Tools / Blast, the results show that, The 100% consensus sequence of the needle is the transcript level sequence of the RARA gene, and only 17 bases overlap with the other gene sequences at most, indicating that the probe has good specificity.

Embodiment 2B

[0094] Example 2 Detection of BCR-ABL1 fusion gene

[0095] Specimen information: Bone marrow specimens from patients with positive BCR-ABL1 fusion gene

[0096] Experimental steps:

[0097] (1) Extract total RNA from bone marrow specimens and use Qubit TM The RNA IQ Assay Kit detects the integrity of the sample RNA, and the integrity of the RNA (RIN value) is required to be greater than or equal to 6.5. The initial total amount of total RNA is required to be in the range of 1-100ng, and the RNA is dissolved in 10 microliters of nuclease-free water.

[0098] (2) Resuspend the starting RNA in Fragmentation, Prep and Elution Buffer (1X), and fragment it into the desired fragment size by incubating at high temperature. The size of the target fragment we need is about 400bp, and the fragmentation conditions are: 85°C, 6 minutes.

[0099] (3) RNA is reversed into cDNA (two-step method), and the first strand is synthesized by random primer combination. When synthesizing the sec...

Embodiment 2

[0110] Implementation of 2 rare BCR-ABL1 fusion gene detection

[0111] Specimen information: bone marrow specimens from patients with positive BCR-ABL1 fusion gene.

[0112] Experimental procedure: with embodiment 2.

[0113]Detection instrument: illumina nextseq550.

[0114] Detection results: BCR-ABL1 (e8a2 type) fusion gene transcripts were detected.

[0115] The analysis results of STAR-FUSION software are shown in Table 2.

[0116] Table 2 BCR-ABL1 (e8a2 type) transcript

[0117]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of gene engineering, in particular to a targeting capture probe of a tumor fusion gene and application of the targeting capture probe. By utilizing the probe combination and combining a high-throughput sequencing technology, fusion genes related to transcription levels BCR, ABL1, RUNX1, CBFB, PML, RARA and KMT2A can be detected, the detection rate is high, the sensitivity is high, the detection period is short, the detection cost is low, and the detection sensitivity reaches more than 1%.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a targeted capture probe of a tumor fusion gene and its application. Background technique [0002] Disease diagnosis and targeted therapy of hematopoietic system tumors rely heavily on the detection of fusion genes. For example, PML-RARA fusion gene-positive acute promyelocytic leukemia is treated with retinoic acid targeted therapy, BCR-ABL1 fusion gene-positive chronic myeloid leukemia is treated with imatinib targeted therapy, CBFB-MYH11 and RUNX1-RUNX1T1 fusion gene-positive acute myeloid leukemia It suggests that the prognosis is better for those who are sensitive to chemotherapy, while the KMT2A fusion gene in acute myeloid leukemia indicates that the prognosis is poorer, and it is often treated with intensive chemotherapy in the middle and high-risk group, and so on. [0003] The current traditional methods for detecting fusion genes mainly include the following: [0004] 1....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886C12N15/11
Inventor沈宏杰
OwnerTHE FIRST AFFILIATED HOSPITAL OF SOOCHOW UNIV