Hybridoma cell strain, anti-grass carp IL-15R alpha monoclonal antibody secreted by hybridoma cell strain and application of monoclonal antibody
A hybridoma cell line and monoclonal antibody technology, applied in the field of protein detection, can solve problems such as the lack of monoclonal antibodies
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Example 1 Preparation of grass carp IL-15Rα antigen
[0021] 1.1 Cloning of grass carp IL-15Rα
[0022] Design specific primers according to the gene sequences of IL-15Rα and its isomers (gene accession numbers: KT192440.1, KT192441.1, KT192442.1, KT192443.1 and KT192444.1) in Genebank, and introduce the upstream primer into the EcoR I enzyme Cutting site, the downstream primer introduces the Xhol I restriction site.
[0023] The upstream primer is: CG GAATTC CATAATTTTGCCAGAGCAAGCG
[0024] Downstream primer: CCG CTCGAG CTATTGTGGCTTTTTGGGATCAGGTA
[0025] Using grass carp head kidney cDNA as a template, PCR amplified the IL-15Rα gene, connected the amplified fragment to the pMD-18T vector, selected the correct plasmid identified by sequencing, performed double enzyme digestion with EcoR I and Xhol I, and digested The final fragment was connected to the pGX-4T-1 plasmid digested by the same restriction site, transformed into DH5α competent cells, and the positive ...
Embodiment 2
[0036] The preparation of embodiment 2 monoclonal antibody
[0037] 2.1 Animal immunity
[0038] 2.1.1 Animals: 5 BALB / c mice aged 6-8 weeks.
[0039] 2.1.2 Antigen: recombinant grass carp IL-15Rα protein prepared in Example 1.
[0040] 2.1.3 Immunization route and procedure: 50 μL (about 40 μg) of recombinant grass carp IL-15Rα protein was thoroughly mixed and emulsified with an equal volume of complete Freund’s adjuvant, and injected subcutaneously at multiple points on the back of the mouse. Two weeks later, two booster immunizations were given, with an interval of two weeks each time. During the booster immunization, the recombinant IL-15Rα protein was mixed and emulsified with equal volumes of Freund's incomplete adjuvant, and injected subcutaneously at multiple points on the back. On the 7th day after the second booster immunization, 20 μL of tail blood was collected, and the antibody titer was detected by ELISA. When the antibody titer reaches the requirement, the im...
Embodiment 3
[0048] Identification of embodiment 3 monoclonal antibody
[0049] 3.1 Antibody Subclasses
[0050] Coat goat anti-mouse IgG1, IgG2a, IgG2b, IgG3, IgA and IgM on ELISA plates respectively, incubate overnight at 4°C or 2h at 37°C; wash 3 times with washing solution, then add 100 μL of the monoclonal antibody to be detected to each well , incubate at 37°C for 1 h; wash 3 times, add diluted horseradish peroxidase-labeled goat anti-mouse multivalent immunoglobulin (IgA, IgM and IgG) antibody, 100 μL per well, incubate at 37°C for 1 h; wash 3 times Afterwards, 100 μL of TMB substrate solution was added to each well, and incubated at 37°C in the dark for 20 min; then, stop solution was added to each well to terminate the reaction. Read OD on microplate reader 450 For the absorbance value, the subtype of the positive reaction well coated is the antibody type of the supernatant to be tested. The identification results show that the anti-grass carp IL-15Rα monoclonal antibody subcla...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More