Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

RPA primer and method for detecting schistosoma japonicum katsurada

A technology for schistosomiasis and amplification products, which is applied in biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve problems such as difficulties in schistosomiasis prevention work, and achieve the effects of high sensitivity, good application prospects and convenient operation.

Pending Publication Date: 2021-05-14
STATION OF VIRUS PREVENTION & CONTROL CHINA DISEASES PREVENTION & CONTROL CENT
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Its many sources of infection and repeated infection often bring great difficulties to the work of schistosomiasis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RPA primer and method for detecting schistosoma japonicum katsurada
  • RPA primer and method for detecting schistosoma japonicum katsurada
  • RPA primer and method for detecting schistosoma japonicum katsurada

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1 RPA Detection of Schistosoma japonicum Adult Samples

[0024] 1) Design RPA primers: select the Sj28S ribosomal gene as the target gene, and design specific primers. Firstly, conduct a large number of sequence analysis and alignment, and then borrow Primer Premier5 software, combined with manual design, and use experimental comparisons to screen out Optimal pair of primers:

[0025] RPA-F: 5'-CTTCGGTTAGTCTGCTGATGGCTTGTTTATG-3' (SEQ ID NO.1)

[0026] RPA-R:5'-CCTTAGTTCGGACTGAAAGCCGAACCTTTACC-3' (SEQ ID NO.2)

[0027] The specific amplification fragment corresponding to the above primers is located between the 851-1066 sites of the reference gene (GenbankZ46504.4) of Schistosoma japonicum, with a size of 216bp, and its nucleotide sequence is:

[0028] 5'-CTTCGGTTAGTCTGCTGATGGCTTGTTTATGTCACGTTGGCAGTTGCGTATGTGAGCTTTTGAATGGGCCAATAGTCTGTGGTGTAGTGGTAGACGATCCACCTGACCCGTCTTGAAACACGGAACCAAGGAGTTTAACATGTGCGCGAGTCATTGGGCGTTACGAAACCCAAAGGCGAAGTGAAGGTAAAGGTTCGGCTTTCAGTCCG...

Embodiment 2

[0036] Example 2 RPA detection method specificity verification

[0037] Genomic DNA of Schistosoma japonicum, Schistosoma mansoni, Schistosoma haematobium, monofurcation cercariae, Clonorchis sinensis, Fasciola gigantea, Paragonimus guardis, Taenia saginata and negative snails were used as templates, and the negative control was sterilized double distilled water , carry out RPA reaction according to the method for embodiment 1, and the amplified product is detected, the results are shown in figure 2 .

[0038] figure 2It shows that only the swimming lane added with Schistosoma japonicum genomic DNA has obvious amplified bands, and the others have no any amplified bands, indicating that the primers of the present invention have high specificity for Schistosoma japonicum, and the RPA detection method has better specificity.

Embodiment 3

[0039] Example 3 RPA detection method sensitivity verification

[0040] 1) Select the total DNA sample of Schistosoma japonicum adult worms to be serially diluted 10 times, select 5 concentration gradients: 100, 10, 1pg / μL, 100, 10fg / μL, and the negative control is sterilized double distilled water, using the method in Example 1 test, see the results image 3 .

[0041] The results show that when the sample concentration is greater than or equal to 100fg / μL, the obvious target band can be amplified; when the sample concentration is 10fg / μL, the corresponding target band can no longer be amplified; the negative control has no amplified band band, indicating that the experimental process was free of pollution. The results showed that the minimum detectable concentration of RPA reaction to the genomic DNA of adult Schistosoma japonicum was 100fg / μL.

[0042] 2) Construct the 472bp target fragment including the sequence of SEQ ID NO.3 on the Puc57-T vector, and extract the reco...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a RPA primer and a method for detecting schistosoma japonicum katsurada, particularly relates to a biological detection technology, and belongs to the technical field of molecular biology. A pair of specific primers is designed according to an Sj28S ribosome gene sequence of the schistosoma japonicum, and an RPA method for nucleic acid detection of the schistosoma japonicum is further established. The method can specifically amplify and detect the nucleic acid of the schistosoma japonicum katsurada, and the lowest detectable genome DNA concentration is 100 fg / mu L. The product has the advantages of high specificity, high sensitivity and high stability, can realize the index amplification of target fragments within 20 minutes, has low requirements on environmental equipment, is suitable for the detection of large-batch samples, and has a better field application prospect.

Description

technical field [0001] The invention relates to the technical field of biological detection, in particular to an RPA primer and a method for detecting Schistosoma japonicum. Background technique [0002] Schistosomiasis is distributed worldwide and is prevalent in 78 countries and regions. Currently, there are six species of schistosomiasis that can cause human schistosomiasis, which are mainly prevalent in tropical and subtropical regions. The main epidemic in my country is schistosomiasis japonicum, which is extremely harmful to humans and animals. Its many sources of infection and repeated infection often bring great difficulties to the work of schistosomiasis. [0003] In recent years, with the development of molecular biology techniques, more and more nucleic acid amplification techniques have been applied to the detection of pathogens. Recombinant enzyme polymerase amplification (RPA) technology is a new nucleic acid reaction technology that can replace PCR. RPA use...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6888C12Q1/6844C12N15/11
CPCC12Q1/6844C12Q1/6888C12Q2521/507C12Q2522/101C12Q2527/125
Inventor 许静王盛琳邓王平李银龙吕山
Owner STATION OF VIRUS PREVENTION & CONTROL CHINA DISEASES PREVENTION & CONTROL CENT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com