Amplification-free RNA quantitative detection method

A quantitative detection method and content technology, applied in the field of molecular biological detection, can solve problems such as complex environmental background, short length of RNA fragments, and high sequence similarity

Pending Publication Date: 2021-05-18
广州市第一人民医院 +1
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] However, due to some characteristics of RNA itself, such as short fragment length, high sequence similarity, large expression difference span, and complex environmental background, its detection, especially the quantitative analysis at the single-molecule level, presents many challenges.
Traditional Northern Blotting and high-throughput sequencing require a series of complex operations, large sample consumption, long analysis time, and low detection sensitivity
qRT-PCR and ddPCR methods based on RT-PCR technology and a series of nucleic acid amplification detection technologies based on CRISPR (clustered regularly interspaced short palindromic repeats) effector proteins (including "SHERLOCK system" and its improved version) have high However, the steps involved in the process, such as reverse transcription and nucleic acid amplification, are easily interfered by various factors and affect the accuracy of quantitative detection.
At present, a series of newly developed RNA quantitative detection methods based on labeling and modification technologies also limit their wide applicability to a certain extent due to the complexity of the labeling / modification process.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Amplification-free RNA quantitative detection method
  • Amplification-free RNA quantitative detection method
  • Amplification-free RNA quantitative detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1, expression and purification of LbuCas13a protein

[0036]First, 100 mg / μL of ampicillin (Shanghai Shengong) was added to the rich medium (Terrific Borth growth media, OXOID). Under the condition of 37°C, the Escherichia coli Rosetta (DE3) constructed with pET28a-His6-SUMO-LbuCas13a plasmid was cultivated in this medium until the bacterial density reached OD (600nm) of 0.6. Then, add isopropyl-1-thio-β-D-galactopyranose (isopropyl-1-thio-b-D-galactopyranoside, purchased from sigma) with a final concentration of 100 μM to the above bacterial culture solution, and lower the temperature to Continue culturing at 26°C for 4 hours to induce protein expression. Next, the bacteria cultured above were collected and ultrasonically lysed after adding a lysis buffer containing 20 mM Tris-HCl, 1 M NaCl, 10% glycerol and pH 7.5. Then the bacterial lysate was centrifuged at 4° C. at a speed of 8000 rpm, and the obtained supernatant was incubated with a nickel-containing...

Embodiment 2

[0037] Example 2, single-molecule RNA detection capability verification

[0038] In order to verify the feasibility of single-molecule RNA detection by the technical solution provided by the present invention, the verification experimental operation steps are as follows:

[0039] (1) Design crRNA-miR-17 (as shown in sequence 2 of the sequence listing) for the microRNA-17 sequence (as shown in sequence 1 of the sequence listing): GACCACCCCAAAAAUGAAGG GGACUAAAAC CCUGCACUGUAAGCACUUU G, the nucleotide sequence shown underlined is complementary to the microRNA-17 sequence.

[0040] (2) Prepare 9 μL of Cas13 reaction system, whose components mainly include 20 nM LbuCas13a protein prepared in Example 1, 10 nM crRNA-miR-17, 300 nM FQ 5U RNA fluorescent reporter probe (FAM-UUUUU-BHQ1) and 1× reaction Buffer, wherein the reaction buffer contains 10mM Tris-HCl, 1.5mM MgCl 2 , 50mM KCl, solution pH 8.9.

[0041] (3) 1 μL of microRNA-17 with a concentration of 100 fM was used as the ta...

Embodiment 3

[0047] Example 3, using gradient dilution micro RNA-17 samples to verify the quantitative detection ability

[0048] (1) Dilute the known concentration of microRNA-17 synthetic target (purchased from Treasure Bioengineering (Dalian) Co., Ltd.) 10-fold gradient to prepare quantitative standards with concentrations of 1pM, 100fM, 10fM, 1fM, 100aM, and 10aM, respectively , while DEPC water without template was used as a negative control.

[0049] (2) Prepare a reaction system whose components mainly include 20nM LbuCas13a protein prepared as in Example 1, 10nMcrRNA-miR-17, 300nM FQ 5U RNA fluorescent reporter probe (FAM-UUUUU-BHQ1) and 1× reaction buffer, Wherein the reaction buffer contains 10mM Tris-HCl, 1.5mM MgCl 2 , 50mM KCl, solution pH 8.9.

[0050] (3) Mix the quantitative standard in step (1) with the reaction system in step (2) above to form a large number of water-in-oil discrete micro-droplets with a diameter of 30 μm, and the number of micro-droplets is not less th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an amplification-free RNA quantitative detection method. The method comprises the following steps: designing a crRNA sequence which is complementarily paired with a target RNA base and has a 5 '-terminal repetitive sequence stem-loop structure; preparing a Cas13 reaction system; mixing an object to be detected with the Cas13 reaction system, dispersing the mixed system into a large number of micro-reaction units which are uniform in size and do not exceed nano-flow, and providing proper temperature conditions to incubate the micro-reaction units; and reading signals of the micro-reaction units after the incubation reaction is completed, and calculating the content of the target RNA in the sample to be detected. According to the amplification-free RNA quantitative detection method disclosed by the invention, RNA quantitative detection at the single molecule level can be realized, internal reference correction and standard curve establishment are not needed, steps of reverse transcription and nucleic acid replication are not needed, marking and functional modification are not needed, thermal circulation is not needed in thermostatic reaction, the operation steps are simple, and the detection precision is high.

Description

technical field [0001] The invention relates to the field of molecular biological detection, in particular to an amplification-free RNA detection and a single-molecule quantitative detection method thereof. Background technique [0002] Ribonucleic acid RNA (Ribonucleic Acid) is a genetic information carrier widely present in biological cells and some viruses and viroids. There are four main bases in RNA, namely A (adenine), G (guanine), C (cytosine), and U (uracil), where U replaces T (thymine) in DNA. There are many forms of RNA, including genomic RNA, messenger RNA (mRNA), transfer RNA (tRNA), ribose RNA (rRNA) and a series of non-coding RNAs (such as microRNA, lncRNA, circRNA, snRNA, cfRNA, etc.), each of which is involved in life play different roles in the process. For example, microRNAs are involved in the regulation of a series of cellular functions such as cell proliferation, differentiation, and death. At the same time, miRNAs can participate in the cellular path...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6851
CPCC12Q1/6851C12Q2525/307C12Q2521/327C12Q2563/159
Inventor舒博文周小明田甜
Owner广州市第一人民医院