Check patentability & draft patents in minutes with Patsnap Eureka AI!

High-expression NAMPT protein-containing exosome and preparation method and application thereof

A high-expression, exosome technology, applied in the biological field, can solve the problems of reduced NAMPT protein content and limited access, and achieve the effect of improving growth state, improving aging, and improving neuron protection.

Pending Publication Date: 2021-06-08
GUIDON PHARM INC
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the existing way of obtaining exosomes containing NAMPT protein is cell autocrine, and the amount obtained is limited; and the content of NAMPT protein in human exosomes will decrease with age

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-expression NAMPT protein-containing exosome and preparation method and application thereof
  • High-expression NAMPT protein-containing exosome and preparation method and application thereof
  • High-expression NAMPT protein-containing exosome and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0026] In view of the defect in the prior art that the expression of NAMPT protein in exosomes is low, the present invention provides an exosome containing highly expressed NAMPT protein and its preparation method and application.

[0027] After the protein is expressed in the cell, there are generally two forms of existence in the body, intracellular protein and extracellular protein (for example, after the protein is expressed in the cell, it is excreted to the outside of the cell along with exosomes), and it is excreted to the outside of the cell. The proteins, DNA, RNA, and lipids wrapped in exosomes are all random, so how to obtain an exosome containing a highly expressed target protein has always been a difficult problem for those skilled in the art. Although the target gene can be transfected into the host cell by means of mRNA transfection or lentivirus infection and can be highly expressed in the host cell, but after high expression, the target protein becomes an intra...

Embodiment 1

[0034] Example 1: In vitro synthesis of NAMPT mRNA to prepare exosomes containing highly expressed NAMPT protein

[0035] 1.1. Cloning of the target gene

[0036] 1.1.1. Primer design

[0037] This step is to add the T7 promoter (TAATACGACTCACTATAGGG, SEQ ID NO: 1) to the 5' end of the PCR product of the human NAMPT gene (full name: nicotinamide phosphoribosyltransferase, the retrieval number in the gene bank is NP_005737), and the 3' end to add multiple Poly A tail, the following primer pairs were synthesized by Sangon Bioengineering Co., Ltd.:

[0038] Forward Primer:

[0039] 5'-GCATGATAATACGACTCACTATAGGGAGTCCACCATGGATGAATCCTGCGGCAGAAG-3' (SEQ ID NO: 2);

[0040] Reverse Primer (reverse primer):

[0041] 5'-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTAATGATGTGCTGCTTCC-3'; (SEQ ID NO: 3)

[0042] The primer pair designed in this step is used in the following steps to obtain the NAMPT gene PCR product with a T7 promoter at the 5' end and a poly A tail at the 3' end.

[0043] 1.1.2...

Embodiment 2

[0072] Example 2: Identification and analysis of exosomes

[0073] In this example, the exosome solution obtained in the above-mentioned Example 1 was used for particle size analysis, western blot and electron microscope analysis and identification, respectively, to confirm that the NAMPT protein exosome was obtained, and its expression level was quantitatively analyzed.

[0074]2.1. Size analysis of exosomes

[0075] Take 20 μl (or an appropriate volume) of the exosome solution obtained in Example 1 above, dilute it to 500 μl with PBS, put it into the instrument Zetaview (brand: Particle Metrix), and operate according to the instrument technical manual to obtain the particle concentration of the exosome solution and size distribution charts.

[0076] Such as figure 1 As shown, the relationship diagram between the particle concentration and particle size distribution of the exosome solution obtained in Example 1 is shown, and it can be seen that the particle size in the exos...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Particle sizeaaaaaaaaaa
Login to View More

Abstract

The invention discloses a high-expression NAMPT protein-containing exosome and a preparation method and application thereof, and belongs to the technical field of biology. According to the invention, the high-expression NAMPT protein-containing exosome is obtained by a method of transfecting NAMPT mRNA synthesized in vitro into an iPS cell, and the content of the NAMPT protein in the exosome is 2 times or more of the content of the NAMPT protein in the exosome secreted by a common iPS cell, and compared with an exosome secreted by the common iPS cell, the high-expression NAMPT protein-containing exosome can remarkably improve the condition of senescent cells and has a remarkable protection effect on neurons.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to an exosome containing highly expressed NAMPT protein and its preparation method and application. Background technique [0002] Nicotinamide phosphoribosyltransferase (NAMPT) exists in two forms in vivo, intracellular NAMPT and extracellular NAMPT (eNAMPT). Among them, NAMPT catalyzes the condensation of nicotinamide and 5-phosphoribosyl-1 pyrophosphate to generate nicotinamide mononucleotide, which is a limited salvage pathway for the synthesis of nicotinamide adenine dinucleotide (NAD). Speed ​​enzyme, and after extracellular NAMPT is expressed in cells, along with exosomes (small membrane vesicles (30-150nm) containing complex RNA and proteins), they are regarded as specifically secreted membrane vesicles and participate in intercellular communication ) to the outside of the cell and has the functions of various cytokines. Studies have shown that NAMPT controls the bi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/10C12N15/54A61K35/12A61P25/00A61P25/28A61P39/06
CPCC12N9/1077A61K35/12A61P25/00A61P25/28A61P39/06C12Y204/02012
Inventor 张建民王靓
Owner GUIDON PHARM INC
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More