High-expression NAMPT protein-containing exosome and preparation method and application thereof
A high-expression, exosome technology, applied in the biological field, can solve the problems of reduced NAMPT protein content and limited access, and achieve the effect of improving growth state, improving aging, and improving neuron protection.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0026] In view of the defect in the prior art that the expression of NAMPT protein in exosomes is low, the present invention provides an exosome containing highly expressed NAMPT protein and its preparation method and application.
[0027] After the protein is expressed in the cell, there are generally two forms of existence in the body, intracellular protein and extracellular protein (for example, after the protein is expressed in the cell, it is excreted to the outside of the cell along with exosomes), and it is excreted to the outside of the cell. The proteins, DNA, RNA, and lipids wrapped in exosomes are all random, so how to obtain an exosome containing a highly expressed target protein has always been a difficult problem for those skilled in the art. Although the target gene can be transfected into the host cell by means of mRNA transfection or lentivirus infection and can be highly expressed in the host cell, but after high expression, the target protein becomes an intra...
Embodiment 1
[0034] Example 1: In vitro synthesis of NAMPT mRNA to prepare exosomes containing highly expressed NAMPT protein
[0035] 1.1. Cloning of the target gene
[0036] 1.1.1. Primer design
[0037] This step is to add the T7 promoter (TAATACGACTCACTATAGGG, SEQ ID NO: 1) to the 5' end of the PCR product of the human NAMPT gene (full name: nicotinamide phosphoribosyltransferase, the retrieval number in the gene bank is NP_005737), and the 3' end to add multiple Poly A tail, the following primer pairs were synthesized by Sangon Bioengineering Co., Ltd.:
[0038] Forward Primer:
[0039] 5'-GCATGATAATACGACTCACTATAGGGAGTCCACCATGGATGAATCCTGCGGCAGAAG-3' (SEQ ID NO: 2);
[0040] Reverse Primer (reverse primer):
[0041] 5'-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTAATGATGTGCTGCTTCC-3'; (SEQ ID NO: 3)
[0042] The primer pair designed in this step is used in the following steps to obtain the NAMPT gene PCR product with a T7 promoter at the 5' end and a poly A tail at the 3' end.
[0043] 1.1.2...
Embodiment 2
[0072] Example 2: Identification and analysis of exosomes
[0073] In this example, the exosome solution obtained in the above-mentioned Example 1 was used for particle size analysis, western blot and electron microscope analysis and identification, respectively, to confirm that the NAMPT protein exosome was obtained, and its expression level was quantitatively analyzed.
[0074]2.1. Size analysis of exosomes
[0075] Take 20 μl (or an appropriate volume) of the exosome solution obtained in Example 1 above, dilute it to 500 μl with PBS, put it into the instrument Zetaview (brand: Particle Metrix), and operate according to the instrument technical manual to obtain the particle concentration of the exosome solution and size distribution charts.
[0076] Such as figure 1 As shown, the relationship diagram between the particle concentration and particle size distribution of the exosome solution obtained in Example 1 is shown, and it can be seen that the particle size in the exos...
PUM
Property | Measurement | Unit |
---|---|---|
Particle size | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com