Method for synthesizing L-phenyllactic acid through whole-cell catalysis of recombinant microorganisms

A technology of phenyllactic acid and host cells, applied in the field of enzyme engineering and genetic engineering, can solve the problems of high cost and pollution of phenyllactic acid

Pending Publication Date: 2021-06-25
JIANGNAN UNIV
View PDF6 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] The technical problem to be solved by the present invention is to provide a genetically engineered bacterium capable of converting phenylalanine into L-phenyllactic acid, and to construct a multi-enzyme cascade that is easy to operate, low in cost, high in conversion rate, and suitable for industrial production The catalytic reaction system realizes the one-step reaction of phenylalanine to L-phenyllactic acid, so as to solve the problems of high cost, low yield and serious pollution of industrial phenyllactic acid production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for synthesizing L-phenyllactic acid through whole-cell catalysis of recombinant microorganisms
  • Method for synthesizing L-phenyllactic acid through whole-cell catalysis of recombinant microorganisms
  • Method for synthesizing L-phenyllactic acid through whole-cell catalysis of recombinant microorganisms

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] Embodiment 1: Construction of phenylpyruvate reductase expression vector

[0067] Specific steps are as follows:

[0068] Using the Lactobacillus sp.CGMCC 9967 genome as a template, the phenylpyruvate reductase gene lappr as shown in SEQ ID NO.5 was amplified, and it was combined with the pET-28a(+) expression plasmid through the restriction endonuclease HindⅢ enzyme Ligation was performed after cutting to obtain the recombinant plasmid pET28a-lappr.

[0069] The primer sequences used to construct the expression vector are as follows:

[0070] Upstream primer (including HindⅢ restriction site): AATTCGAGCTCCGTCGAC AAGCTT GATGGGCAGCAGCCATCA (SEQ ID NO. 7);

[0071] Downstream primer (including HindⅢ restriction site): GGTGCTCGAGTGCGGCCGC AAGCTT TTAATAGCCGCGGGTCAGAT (SEQ ID NO. 8).

Embodiment 2

[0072] Embodiment 2: Construction of glucose dehydrogenase expression vector

[0073] Specific steps are as follows:

[0074] Using the Bacillus subtilis genome as a template, the glucose dehydrogenase gene as shown in SEQ ID NO.6 was amplified, and it was combined with the pET28a-lappr expression plasmid constructed in Example 1 through the restriction endonuclease NcoI Ligation was performed after digestion to obtain the recombinant plasmid pET28a-lappr-gdh.

[0075] The primer sequences used to construct the expression vector are as follows:

[0076] Upstream primer (including NcoⅠ restriction site): ACTTTAAGAAGGAGATATA CCATGG ATGGGTTATCCGGATTTAAAAGGAAAAG (SEQ ID NO. 9);

[0077] Downstream primer (including NcoⅠ restriction site): TGATGATGATGATGATGGCTGCTGC CCATGG TTAACCGCGGC (SEQ ID NO. 10).

Embodiment 3

[0078] Embodiment 3: Construction of L-amino acid deaminase expression vector

[0079] Specific steps are as follows:

[0080] Using the Proteus vulgaris genome as a template, the L-amino acid deaminase gene as shown in SEQ ID NO.4 was amplified, and it was restricted with the pET28a-lappr-gdh expression plasmid constructed in Example 2. Endonuclease XhoI digested and ligated to obtain recombinant plasmid pET28a-lappr-gdh-laad.

[0081] The primer sequences used to construct the expression vector are as follows:

[0082] Upstream primer (including XhoⅠ restriction site): AAGCTTGCGGCCGCA CTCGAG TAATACGACTCACTATAGGGGAATTGTGAG (SEQ ID NO. 11);

[0083] Downstream primer (including XhoI restriction site): GGTGGTGGTGGTG CTCGAG TTAAAAACGATATAAAGAAAACGGCTTCGGG (SEQ ID NO. 12).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for synthesizing L-phenyllactic acid through whole-cell catalysis of recombinant microorganisms, and belongs to the technical field of enzyme engineering and genetic engineering. The invention provides an effective conversion system for synthesizing L-phenyllactic acid through whole-cell catalysis of phenylalanine by multi-enzyme tandem recombinant escherichia coli. According to the system, L-amino acid deaminase and phenylpyruvate reductase are used for catalyzing phenylalanine to synthesize L-phenyllactic acid for the first time, so that L-amino acid deaminase is successfully realized; a phenylpyruvate reductase and glucose dehydrogenase co-expression strain are constructed. The final yield reaches 21.39 g / L, and the molar conversion rate is 71.33%. Whole-cell catalytic synthesis of phenyllactic acid is adopted, the operation process is convenient, the conversion efficiency is superior to that of a previous L-phenyllactic acid biosynthesis method, theoretical and practical foundations are laid for industrial production and application of L-phenyllactic acid, and certain guiding significance is achieved.

Description

technical field [0001] The invention relates to a method for catalyzing and synthesizing L-phenyllactic acid by using whole cells of recombinant microorganisms, belonging to the technical fields of enzyme engineering and genetic engineering. Background technique [0002] Phenyllactic acid (PLA), namely 2-hydroxy-3-phenylpropionic acid, is a small molecular natural organic acid widely found in cheese and natural honey. As a natural antibacterial substance, it has spectral inhibitory effect on a variety of pathogenic microorganisms, but has no toxicity to human and animal cells. It has good solubility and can be evenly dissolved in aqueous solvents. In addition, phenyllactic acid has the characteristics of acid resistance, alkali resistance and high temperature resistance, and can effectively inhibit the growth of scavenging microorganisms, so it has broad application prospects in the food industry. [0003] As one of the two enantiomers of phenyllactic acid, L-phenyllactic ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12P7/42C12R1/19
CPCC12N15/52C12N9/0022C12N9/0006C12P7/42C12Y104/03002C12Y101/01
Inventor饶志明邵宇张显徐美娟杨套伟邵明龙
OwnerJIANGNAN UNIV