Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Combination drugs for the treatment of kras mutation and myocd loss of function lung cancer

A function-deficient, lung cancer technology, applied in the field of combined drugs for the treatment of K+/M- lung cancer, can solve the problems of unimproved effects, loss of activity, and lack of targeted drugs

Active Publication Date: 2021-12-31
JINAN UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, some drugs can be combined with KRAS-G12C to inactivate it, and some inhibitors against MEK1 / 2 can also partially eliminate KRAS-mutated tumors, but lung cancer cells quickly develop resistance to these drugs, so In clinical treatment, the effect needs to be improved
The nearly spherical structure of KRAS makes it a very smooth target. Except for the G12C mutation, there is currently no clinically effective targeted drug. In addition, KRAS-mutated lung cancer cells are also resistant to chemotherapy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Combination drugs for the treatment of kras mutation and myocd loss of function lung cancer
  • Combination drugs for the treatment of kras mutation and myocd loss of function lung cancer
  • Combination drugs for the treatment of kras mutation and myocd loss of function lung cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Construction of lung cancer cell model with MYOCD deletion KRAS-G12D mutation and the effect of MYOCD deletion on the stemness of KRAS-G12D mutation lung cancer cells.

[0052] 1. Experimental method

[0053] (A) Construction of a MYOCD-inducible knockdown cell line in A549 cells: A549 cells carry the KRAS-G12D mutation. First, the expression vector pLKO.1-teton-shMYOCD1 (MYOCD-shRNA sequence: GACTTGGTTAATATGCACAT) and the lentiviral backbone vector psPAX and PM2.G were co-transfected into 293T cells for lentiviral packaging. The virus produced by the 293T cells was collected to infect A549 cells, and then screened with 1 μg / mL Puromycin (MCE, HY-B1743A). mL) were treated for 48 hours, and the cells were collected. The harvested cells were lysed on ice for 30 minutes with RIPA lysate (Biyuntian), then added 5X SDS loading buffer, boiled at 95°C for 10 minutes, centrifuged at 12000g for 10 minutes, and the supernatant was used for polyacrylamide gel electrophoresis (10...

Embodiment 2

[0060] Inhibitory effect of SB525334 on MYOCD-deleted KRAS-mutated lung cancer cells.

[0061] 1. Experimental method

[0062] (A) Sphere cell sphere formation assay to evaluate the sensitivity of KRAS-G12D mutant cells to SB525334 after MYOCD deletion: 500 cells / well were seeded in low-adsorption 6-well plates (CORNING, 3471), and serum-free DMEM / F12 medium (Gibco, 11330-032), containing 20μL / mL B27 (ThermoFisher, 17504044), 20ng / mLbasicFGF (Peprotech, AF-100-18B-100ug) and 20ng / mL EGF (ThermoFisher, PHG0311) for cultivation, while After treatment with or without tetracycline (Dox: 1μg / mL) for 3 days, they were treated with DMSO or SB525334 (1μM) respectively, and the cells were photographed 10 days later, see figure 2 a.

[0063] (B) Perform statistics on the clonal spheres formed by the above cells, evaluate and analyze the drug effect of SB425334, see figure 2 b.

[0064] 2. Experimental results and analysis

[0065] In the sphere formation assay to detect cell stem...

Embodiment 3

[0067] Inhibition of WYC209 on MYOCD-deleted KRAS-mutated lung cancer cells.

[0068] 1. Experimental method

[0069] The experimental method refers to the implementation case 2, the difference is that the same dose of WYC209 is used instead of SB525334, refer to image 3 .

[0070] 2. Experimental results and analysis

[0071] In the sphere formation assay to detect cell stemness, DOX-induced MYOCD knockdown significantly enhanced the stemness ability of A549 lung cancer cells, while WYC209 treatment alone had no effect on the stemness ability of A549 lung cancer cells with MYOCD downregulated.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a combination drug for treating K+ / M-lung cancer, aiming to provide a combined treatment drug for individualized treatment of K+ / M-lung cancer patients aiming at activated signal pathways; the technical key point is transforming growth The invention consists of a factor beta receptor I inhibitor, a retinoic acid receptor RAR inhibitor and trametinib; it belongs to the field of medical biotechnology.

Description

technical field [0001] The invention relates to a combined drug for treating lung cancer, in particular to a combined drug for treating K+ / M- lung cancer, belonging to the technical field of medicine. Background technique [0002] There are about 787,000 new lung cancer patients in my country every year, and about 631,000 deaths, which is equivalent to 1.5 people suffering from lung cancer every minute, accounting for about one-fifth of all new cases of malignant tumors. It is currently known that the occurrence of lung cancer is mainly related to gene changes, and the inactivation of tumor suppressor genes and the activation of oncogenes jointly drive the occurrence of cancer. [0003] KRAS is the most common mutated oncogene in lung cancer. Several common gene mutation types of KRAS, G12D, G12V, G12C and G13D mutations, lock KRAS in the conformation binding GTP, and continuously activate downstream signaling pathways to promote the development of malignant tumors . At pr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K31/506A61K31/497A61K31/519A61P35/00
CPCA61K31/506A61K31/497A61K31/519A61P35/00A61K2300/00
Inventor 周倩陈良梁锦霞
Owner JINAN UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com