Combination drugs for the treatment of kras mutation and myocd loss of function lung cancer
A function-deficient, lung cancer technology, applied in the field of combined drugs for the treatment of K+/M- lung cancer, can solve the problems of unimproved effects, loss of activity, and lack of targeted drugs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] Construction of lung cancer cell model with MYOCD deletion KRAS-G12D mutation and the effect of MYOCD deletion on the stemness of KRAS-G12D mutation lung cancer cells.
[0052] 1. Experimental method
[0053] (A) Construction of a MYOCD-inducible knockdown cell line in A549 cells: A549 cells carry the KRAS-G12D mutation. First, the expression vector pLKO.1-teton-shMYOCD1 (MYOCD-shRNA sequence: GACTTGGTTAATATGCACAT) and the lentiviral backbone vector psPAX and PM2.G were co-transfected into 293T cells for lentiviral packaging. The virus produced by the 293T cells was collected to infect A549 cells, and then screened with 1 μg / mL Puromycin (MCE, HY-B1743A). mL) were treated for 48 hours, and the cells were collected. The harvested cells were lysed on ice for 30 minutes with RIPA lysate (Biyuntian), then added 5X SDS loading buffer, boiled at 95°C for 10 minutes, centrifuged at 12000g for 10 minutes, and the supernatant was used for polyacrylamide gel electrophoresis (10...
Embodiment 2
[0060] Inhibitory effect of SB525334 on MYOCD-deleted KRAS-mutated lung cancer cells.
[0061] 1. Experimental method
[0062] (A) Sphere cell sphere formation assay to evaluate the sensitivity of KRAS-G12D mutant cells to SB525334 after MYOCD deletion: 500 cells / well were seeded in low-adsorption 6-well plates (CORNING, 3471), and serum-free DMEM / F12 medium (Gibco, 11330-032), containing 20μL / mL B27 (ThermoFisher, 17504044), 20ng / mLbasicFGF (Peprotech, AF-100-18B-100ug) and 20ng / mL EGF (ThermoFisher, PHG0311) for cultivation, while After treatment with or without tetracycline (Dox: 1μg / mL) for 3 days, they were treated with DMSO or SB525334 (1μM) respectively, and the cells were photographed 10 days later, see figure 2 a.
[0063] (B) Perform statistics on the clonal spheres formed by the above cells, evaluate and analyze the drug effect of SB425334, see figure 2 b.
[0064] 2. Experimental results and analysis
Embodiment 3
[0067] Inhibition of WYC209 on MYOCD-deleted KRAS-mutated lung cancer cells.
[0068] 1. Experimental method
[0069] The experimental method refers to the implementation case 2, the difference is that the same dose of WYC209 is used instead of SB525334, refer to image 3 .
[0070] 2. Experimental results and analysis
[0071] In the sphere formation assay to detect cell stemness, DOX-induced MYOCD knockdown significantly enhanced the stemness ability of A549 lung cancer cells, while WYC209 treatment alone had no effect on the stemness ability of A549 lung cancer cells with MYOCD downregulated.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



