Unlock instant, AI-driven research and patent intelligence for your innovation.

Molecular markers co-segregated with watermelon plant branchless gene Clbl and application

A technology of molecular markers and co-separation, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve problems that have not been reported, reduce manpower and material resources, improve efficiency, and shorten the selection period Effect

Active Publication Date: 2021-07-23
HENAN AGRICULTURAL UNIVERSITY
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

With the completion of the whole genome sequencing of watermelon, related research on watermelon has developed rapidly in recent years, many excellent traits have been gene mapped, and some linkage markers developed have also begun to be used in the process of molecular marker-assisted breeding. The research on few lateral branches of watermelon plants has not been reported yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular markers co-segregated with watermelon plant branchless gene Clbl and application
  • Molecular markers co-segregated with watermelon plant branchless gene Clbl and application
  • Molecular markers co-segregated with watermelon plant branchless gene Clbl and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Obtaining of Molecular Markers Closely Linked to Watermelon Plant Few Side Branch Genes

[0035] Material Description

[0036] Male parent: WM203 watermelon material with few lateral branches (National Watermelon and Melon Medium-Term Bank No.: ZXG00144), provided by the Zhengzhou Fruit Tree Research Institute of the Chinese Academy of Agricultural Sciences. After long-term field observation, this material produces fewer lateral branches during plant growth ;

[0037] Female parent: normal and common side branch material WT2, the side branch differentiation of this material is normal during the plant growth process, the above materials can be provided through commercial channels or the melon crop genetics and breeding research group of Henan Agricultural University.

[0038] 1. Construction of genetic segregation populations

[0039] Taking WM203 as the male parent, its characteristics are as follows: each internode in the lower part of the plant grows norma...

Embodiment 2

[0054] Embodiment 2 Utilizes above-mentioned molecular markers to identify whether watermelon is a kind with few side branches

[0055] 1. DNA extraction from watermelon tissue

[0056] The DNA of the watermelon sample tissue was extracted by the conventional CTAB method, and the RNA was removed, and the DNA sample volume was not less than 50 μL. Measure the OD value of the DNA sample at 260nm and 280nm with an ultraviolet spectrophotometer, and calculate the DNA content and the ratio of OD260 / 280. The OD260 / 280 value of the DNA sample purity should be 1.8-2.0, and the concentration should be diluted to 100ng / μL.

[0057] 2. Primer selection

[0058] dCAPS10 uses the following primer sequences:

[0059] Upstream primer: CTTGCAGCAGTTTCTCTTGA (as shown in SEQ.ID.NO.1);

[0060] Downstream primer: TGGGTGATGAGACAGGAAAAG (as shown in SEQ.ID.NO.2);

[0061] dCAPS13 uses the following primer sequences:

[0062] Upstream primer: GTAAACATCTCGAATTTGTTGATC (as shown in SEQ.ID.NO.3)...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses two pairs of molecular markers co-segregated with a watermelon plant branchless gene Clbl and application, and belongs to the technical field of biology. The molecular markers can be directly used for molecular marker-assisted breeding of watermelon branchless materials, the breeding selection efficiency is improved, the breeding process is accelerated, and the molecular markers have good application value in breeding of new varieties of watermelon branchless ideal plant types. In addition, the molecular markers can be used for accurately and quickly identifying whether watermelon plants have branchless characters or not in the seedling stage, and have the advantages of convenience in detection and stability of amplification products.

Description

technical field [0001] The invention belongs to the technical field of molecular breeding, and in particular relates to a molecular marker co-separated with a watermelon plant less lateral branch gene Clbl and its application. Background technique [0002] Selection is one of the most important links in breeding, which refers to selecting genotypes that meet the requirements in a population for subsequent breeding. However, in the traditional breeding process, the basis for selection is often determined by the phenotype of the plant, which often takes a long time and may deviate from the genotype, resulting in inaccurate selection and low efficiency. However, the use of molecular marker-assisted breeding can quickly detect the target gene or the locus closely linked with the target trait, and achieve the purpose of selecting the target trait, which has the advantages of being fast, accurate, and free from environmental interference. [0003] The dCAPS (derivative cleavage a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/156C12Q2600/13
Inventor 杨路明刘文革豆峻岭杨会会杨森朱华玉
Owner HENAN AGRICULTURAL UNIVERSITY