Molecular markers co-segregated with watermelon plant branchless gene Clbl and application
A technology of molecular markers and co-separation, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve problems that have not been reported, reduce manpower and material resources, improve efficiency, and shorten the selection period Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1 Obtaining of Molecular Markers Closely Linked to Watermelon Plant Few Side Branch Genes
[0035] Material Description
[0036] Male parent: WM203 watermelon material with few lateral branches (National Watermelon and Melon Medium-Term Bank No.: ZXG00144), provided by the Zhengzhou Fruit Tree Research Institute of the Chinese Academy of Agricultural Sciences. After long-term field observation, this material produces fewer lateral branches during plant growth ;
[0037] Female parent: normal and common side branch material WT2, the side branch differentiation of this material is normal during the plant growth process, the above materials can be provided through commercial channels or the melon crop genetics and breeding research group of Henan Agricultural University.
[0038] 1. Construction of genetic segregation populations
[0039] Taking WM203 as the male parent, its characteristics are as follows: each internode in the lower part of the plant grows norma...
Embodiment 2
[0054] Embodiment 2 Utilizes above-mentioned molecular markers to identify whether watermelon is a kind with few side branches
[0055] 1. DNA extraction from watermelon tissue
[0056] The DNA of the watermelon sample tissue was extracted by the conventional CTAB method, and the RNA was removed, and the DNA sample volume was not less than 50 μL. Measure the OD value of the DNA sample at 260nm and 280nm with an ultraviolet spectrophotometer, and calculate the DNA content and the ratio of OD260 / 280. The OD260 / 280 value of the DNA sample purity should be 1.8-2.0, and the concentration should be diluted to 100ng / μL.
[0057] 2. Primer selection
[0058] dCAPS10 uses the following primer sequences:
[0059] Upstream primer: CTTGCAGCAGTTTCTCTTGA (as shown in SEQ.ID.NO.1);
[0060] Downstream primer: TGGGTGATGAGACAGGAAAAG (as shown in SEQ.ID.NO.2);
[0061] dCAPS13 uses the following primer sequences:
[0062] Upstream primer: GTAAACATCTCGAATTTGTTGATC (as shown in SEQ.ID.NO.3)...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


