Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for guiding editing system to mediate crops to generate endogenous herbicide resistance

An editing system and herbicide technology, applied in botany equipment and methods, biochemical equipment and methods, plant products, etc., can solve the problems of lack of germplasm resources, long cycle, increased weeding costs, etc.

Active Publication Date: 2021-08-03
RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the traditional breeding method has a long cycle and the available germplasm resources are scarce. Therefore, it is necessary to cultivate herbicide-resistant rice
[0003] Due to the widespread use of chemical herbicides, weed resistance has developed so quickly and on such a wide scale that it not only increases the cost of weed control, but also increases the pressure on the environment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for guiding editing system to mediate crops to generate endogenous herbicide resistance
  • Method for guiding editing system to mediate crops to generate endogenous herbicide resistance
  • Method for guiding editing system to mediate crops to generate endogenous herbicide resistance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment 1, plant ACCase mutation site acquisition and the construction of plant expression vector

[0035] Taking rice as an example, select the nucleotide sequence TTCCTCGTGCTGGACAAGTG in the plant ACC gene TGG and many others point (The underlined part is the PAM sequence of the 5'NGG-3' structure), as the targeting site. Synthesize (General Biology Co., Ltd.) forward oligonucleotide chain and complementary reverse oligonucleotide chain according to the selected target site. The specific sequence is shown in Table 1:

[0036]

[0037] Table 1

[0038] CRISPR-mediated guide editing system

[0039] The present invention uses SpCas9 protein-mediated guided editing system pHUN411-PE2, which can introduce random mutations of pre-designed NNN into the genome. The pHUN411-PE2 vector was digested with BsaI endonuclease (NEB Company) at 37°C for 4 hours, and the enzyme digestion system was inactivated at 65°C for 10 minutes, as the backbone fragment for constructin...

Embodiment 2

[0040] Embodiment 2, positive transgenic plant obtains

[0041]After removing the chaff of mature rice seeds, soak the seeds with 70% alcohol for 1 min, and pour off the alcohol. Soak the seeds for 40min (150r / min) with a solution of 50% sodium hypochlorite (the concentration of available chlorine in the stock solution is greater than 4%) containing 1 drop of Tween20. Pour off the sodium hypochlorite, wash with sterile water 5 times until the solution is clear, without the smell of sodium hypochlorite. Soak the seeds in sterile water overnight. The seeds were peeled off the embryo along the aleurone layer with a scalpel, and the embryo was inoculated on the callus induction medium. After 11 days of dark culture at 30°C, the callus was separated from the endosperm and germ, and the primary callus in a good state of degermination and vigorous division was pre-cultured for 3 to 5 days and then used for Agrobacterium transformation.

[0042] The genetic transformation mediated ...

Embodiment 3

[0043] Example 3: Analysis of Mutation Sites of Plant Resistance Acetyl-CoA Carboxylase Herbicide Mutant 2097

[0044] The leaves of the obtained herbicide-resistant mutant plants were selected and genomic DNA was extracted, and sent to Invitrogen Company for amplification and monocloning. Comparing the sequencing results with the wild-type Nipponbare ACCase gene, it was found that base mutations occurred at different target positions of the ACCase gene. It should be noted that these mutant plants were obtained by selection under the condition of herbicide as the selection pressure.

[0045] see figure 2 , the inventor transplanted the wild type and two kinds of mutant plants into the soil, and after spraying 0.15g / L haloxyfop 2 times every 3 days, the mutant plants showed resistance to herbicides, and the three bunches of plants They are the wild-type plant, the plant with the 2139th site mutated into asparagine and valine, and the plant with the 2139th site mutated into s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for guiding an editing system to mediate crops to generate endogenous herbicide resistance. According to the invention, various herbicide-resistant ACCase mutant genotypes are obtained, and the ACCase mutant genes respectively obtain single amino acid mutation at different sites. The ACCase mutant gene is obtained by utilizing a CRISPR-mediated guide editing system, specifically, the 1879th amino acid is mutated into leucine, threonine, valine, serine, methionine and the like from isoleucine, the 1927th amino acid is mutated into tyrosine or phenylalanine from proline, the 2097th amino acid is mutated into glycine, serine or leucine from tryptophan, and the ACCase mutant gene is mutated into leucine, threonine, valine, serine, methionine and the like from tryptophan. The 2139th site is mutated into aspartic acid, valine and serine from isoleucine, the 2176th site is mutated into glycine from aspartic acid, and the 2194th site is mutated into serine and alanine from glycine. These ACCase mutant genes endow receptor plants with resistance (tolerance) to acetyl-CoA carboxylase inhibitor herbicides to varying degrees.

Description

technical field [0001] The invention belongs to the fields of plant genetic engineering and plant herbicide-resistant breeding. The invention uses a guided editing system to obtain multiple types of ACCase gene mutant herbicide-resistant rice lines. Background technique [0002] Food shortage is one of the most serious global problems in this century. In recent years, with the rapid development of social economy and continuous improvement of agricultural technology, the problem of food shortage has been alleviated. However, in order to meet the ever-expanding food demand due to rapid population growth , there is an urgent need to increase rice yield and improve rice quality. With the large-scale application of rice direct seeding cultivation technology in agricultural production, the problem of weeds in farmland in rice direct seeding production has become an important factor affecting crop yield. In order to control weeds in rice fields, not only a lot of manpower, materia...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/84C12N15/55C12N15/52C12N9/00A01H5/00A01H6/46
CPCC12N15/8218C12N15/8274C12N15/8205C12N9/22C12N9/93C12Y604/01002
Inventor 李娟许蓉芳魏鹏程秦瑞英刘小双
Owner RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More