Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A tobacco, gene technology, applied in applications, DNA/RNA fragments, genetic engineering, etc.
Active Publication Date: 2021-09-10
ZHENGZHOU TOBACCO RES INST OF CNTC
View PDF4 Cites 3 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
However, whether other genes in this family have similar functions in tobacco needs further research to be further determined
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0075] This example first NtAAP3 Gene, NtAAP6 The brief introduction of the gene acquisition process is as follows.
[0076] (1) Design of primers for PCR amplification
[0077] Based on the existing tobacco genome sequence, targeting the target gene NtAAP3 , NtAAP6 The primer sequences for PCR amplification were designed respectively as follows:
[0078] Upstream primer NtAAP3-F: 5'-ATGGGAGAAAACAACAACGTTGC-3',
[0079] Downstream primer NtAAP3-R: 5'-TCAAGTCGTCTTAAAAGGCTTG-3';
[0080] Upstream primer NtAAP6-F: 5'-ATGGCACCCGAATTTCAGAAGAA-3',
[0081] Downstream primer NtAAP6-R: 5'-TTATTGTTGAGTTGAGAAAGGC-3'.
[0082] (2) Preparation of templates for PCR amplification
[0083] The leaves of Honghua Dajinyuan tobacco were used as the sample source, and after freezing and grinding in liquid nitrogen, the reference EasyPure PlantRNA Kit instructions, extract total RNA, use NanoDrop 2000 ultra-micro spectrophotometer to detect the concentration and purity of RNA, and en...
Embodiment 2
[0113] On the basis of Example 1, in order to determine NtAAP3 , NtAAP6 For the specific functions of the genes, using CRISPR / Cas9 technology, the inventors further constructed a gene editing vector and performed gene silencing to clarify the functions of these two genes. In this embodiment, the relevant experimental conditions are briefly introduced as follows.
[0114] (1) Gene editing vector construction
[0115] (1) First, for NtAAP3 Gene (target site specific sequence: GTGACTGAATCCAAGTGCTTTG), design and edit the primer sequence as follows:
[0121] (2) Subsequently, refer to the Annealing Buffer for DNA Oligos (5×) kit...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
PUM
Login to view more
Abstract
The invention belongs to the technical field of tobacco genome gene function analysis, and particularly relates to application of a tobacco NtAAP3 gene in tobacco. The tobacco NtAAP3 is related to amino acid transport, and after the tobacco NtAAP3 is silenced, the contents of tyrosine, proline and asparagine in tobacco are obviously reduced, and the total protein content is obviously reduced; and on the other hand, the tobacco NtAAP3 gene is related to adjustment of the content of pigment substances in tobacco, and after the tobacco NtAAP3 gene is silenced, the content of the pigment substances such as chlorophyll a / b, total chlorophyll and carotenoid in tobacco leaves is obviously increased. According to the application, the relationship between the NtAAP3 gene and amino acid regulation, protein content regulation and pigment content regulation is preliminarily determined, and a theoretical foundation is laid for elaborating the functions of the NtAAP3 gene in the aspects of absorption and transport of amino acid, nitrogen utilization, regulation of plant stress resistance and the like.
Description
technical field [0001] The present invention belongs to the technical field of tobacco genome gene function analysis, and specifically relates to tobacco NtAAP3 Patent application for gene application in tobacco. Background technique [0002] As the basic unit of enzymes and proteins, amino acids are not only carriers of organic nitrogen in plants and precursors of important secondary metabolites, but also play a vital role in plant growth and development. Plants can absorb inorganic nitrogen in the form of ammonium salts and nitrates from the soil through their roots and assimilate them into amino acids, or they can absorb amino acids directly from the soil, and they can also synthesize amino acids autonomously in their leaves. The absorption and transport of amino acids in plants depends on the amino acid transporter, which is located on the biofilm. According to the sequence homology and function, it is divided into: APC superfamily (aminoacid, polyamine and choline tran...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to view more 
Login to view more