Unlock instant, AI-driven research and patent intelligence for your innovation.

A self-cleaving protein label, modification method and application thereof

A self-shearing, protein technology, applied in the field of protein purification, can solve the problems of secondary use load reduction, influence on medium reuse, incomplete elution, etc., to optimize regeneration effect, improve regeneration effect, and improve elution effect Effect

Active Publication Date: 2022-04-15
JIANGNAN UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] During use, it was found that under weakly alkaline elution conditions, I C The -GFP complex cannot be completely eluted after being applied to the column; under strong basic elution conditions, part I N The protein will be denatured, both of which will lead to a decrease in the capacity of the secondary use, affecting the reuse of the medium

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A self-cleaving protein label, modification method and application thereof
  • A self-cleaving protein label, modification method and application thereof
  • A self-cleaving protein label, modification method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0073] Primer design:

[0074] The C-terminal splicing domain of the natural break-type intein Cfa DnaE was molecularly modified by PCR technology, and the modified I C Fragment Named I C * . According to the gene sequence provided by GeneBank, the molecular biology software PrimerPremier 5 was used to design I based on overlapping PCR. C * Forward primers A_F, B_F, C_F, D_F and reverse primers A_R, B_R, C_R, D_R:

[0075] A_F:AAGCCTGGGTACCCAAAACGTTGGAGGAGGATACGGCATTGGC

[0076]A_R:GCCAATGCCGTATCCTCCTCCAACGTTTTGGGTACCCAGGCTT

[0077] B_F: GGAGGAGGAGGAGGAGGATACGGCATTGGCGTCG

[0078] B_R: TCCTCCTCCTCCTCCTCCAACGTTTTGGGTACCC

[0079] C_F: GGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGATACGG

[0080] C_R: TCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCAACGT

[0081] D_F: ACGTTGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGATACGG

[0082] D_R: CCGTATCTCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCAACGT

[0083] Among them, primers A_F, A_R can construct bacterial strain pET28a-I ...

Embodiment 2

[0086] recombinant vector pET28a-I C * The build:

[0087] Extract plasmid pET28a-I C , using the forward primers A_F, B_F, C_F, D_F and reverse primers A_R, B_R, C_R, D_R designed in Example 1 as primers, plasmid pET28a-I C As a template, use Prime STAR DNA polymerase to pET28a-I C * 12-3G-13, pET28a-I C * 12-6G-13, pET28a-I C * 12-12G-13, pET28a-I C * 12-18G-13 sequence for PCR. According to the instructions of Prime STAR DNA polymerase, select 50 μL system to carry out.

[0088] PCR reaction conditions: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing temperature at 65°C for 30 s, extension temperature at 72°C for 5 min and 30 s, and 30 cycles; finally, 72°C for 10 min.

[0089] Plasmid pET28a-I was recovered using an agarose gel recovery kit C * 12-3G-13, pET28a-I C * 12-6G-13, pET28a-I C * 12-12G-13, pET28a-I C * 12-18G-13. Transform the competent cell E.coliJM109 with the recombinant plasmid to obtain the recombinant strai...

Embodiment 3

[0091] recombinant vector pET-28a-I C * The build:

[0092] Overnight culture of strain E.coli JM109 / pET28a-I C * , extract the plasmid, transform the competent E.coli BL21(DE3), and obtain the transformed recombinant I C * Expression strain E.coli BL21(DE3) / pET28a-I C * spare.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a modification method and product of a self-cleaving protein tag and its application, wherein, the construction of the affinity ligand is to Cfa DnaE-C, i.e. I C carried out on the basis of the transformation of the structure; in I C An appropriate amount of glycine is added to the appropriate position between No. 12 and No. 18 to reduce the I C The structural stability of the protein is used to optimize the elution conditions and improve the elution effect. The present invention changes the I C The protein did not have a significant impact on the intein recognition connection, and it can be seen that the fragmentation rate did not decrease significantly during the fragmentation reaction. In addition, the modification of the present invention has no obvious impact on the capacity of the affinity medium, and it can be seen that the capacity of the affinity medium decreases slightly during the static adsorption experiment. The affinity purification medium constructed by the invention has better purification effect and higher reuse rate.

Description

technical field [0001] The invention belongs to the field of protein purification, and relates to a modification method and product of a self-cleaving protein tag and its application. Background technique [0002] In recent years, with the continuous development of biotechnology, more and more people pay attention to purification technology. Affinity chromatography technology is one of the effective means for the separation and purification of recombinant proteins, which has the characteristics of easy operation and high purification efficiency, but affinity chromatography technology usually requires the introduction of special affinity tags into the target protein. The commonly used de-labeling methods in industry include endonuclease method, chemical method, etc., but the processing methods are often time-consuming, labor-intensive and very expensive. [0003] Intein is a gene sequence inserted into the precursor protein, which can undergo self-splicing during the process...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/00C12N15/70C12N15/62C07K19/00C07K1/22
CPCC07K14/00C12N15/70C12N15/62C07K2319/00C07K2319/60
Inventor 夏海锋罗久沛周挺峻
Owner JIANGNAN UNIV