Preparation method of fermented beverage rich in soybean isoflavone aglycone

A technology for isoflavone aglycone and fermented beverages, applied in the field of preparation of fermented beverages, can solve problems such as heavy workload and cumbersomeness, and achieve the effects of avoiding blindness, broad application prospects and economic significance

Pending Publication Date: 2021-10-29
SUZHOU UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are a large number of screening and detection steps in the above technologies, and the workload is heavy and cumbersome.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of fermented beverage rich in soybean isoflavone aglycone
  • Preparation method of fermented beverage rich in soybean isoflavone aglycone

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0025] The object of the present invention is to provide a kind of preparation method of the fermented beverage that is rich in soybean isoflavone aglycone, specifically comprises the following steps:

[0026] (1) Query the genomic DNA of Lactococcus lactis β-glucosidase (see the L.lactis MG1363Usp45 published by GeneBank (Accession: M60178.1) for the gene sequence), design PCR primers according to the DNA sequence, and the primers are forward: GAAGATCTATGGATGAACTGGCGT ( BglII) Reverse: CCATCGATTTATTGCACCTTGG (ClaI), inside the brackets is the enzyme cutting site.

[0027] (2) Genomic DNA was then extracted from Lactococcus lactis using DNAiso.

[0028] (3) The genomic DNA is used as a reaction template, and the designed primers are amplified by a PCR instrument, and the resulting high-copy number β-glucosidase DNA fragments are connected to the successfully digested plasmids, and then transferred into E. coli for subsequent Amplify, identify, and obtain positive plasmids.

...

Embodiment 1

[0034] Preparation method of fermented beverage rich in soybean isoflavone aglycone:

[0035] (1) Check the genomic DNA of Lactococcus lactis β-glucosidase (for the gene sequence, see L. lactis MG1363Usp45 published by GeneBank (Accession: M60178.1), and design the primer sequence forward according to the DNA fragment: GAAGATCTATGGATGAACTGGCGT (BglII) Reverse: CCATCGATTTATTGCACCTTGG (ClaI).

[0036] (2) Use DNAiso to extract the genomic DNA of Lactococcus lactis, use the whole genome DNA as a template, add reagents from Takara Company, and perform PCR amplification with primers. °C for 10 min, and the reaction was terminated at 16 °C. The resulting product was subjected to agarose gel electrophoresis and purified using the AxyGEN Gel Recovery Kit.

[0037] (3) Digest the expression vector Pet28a(+) with BglII and ClaI enzymes from Takara Company, and carry out gel recovery and purification of the obtained product. The amplified fragments were mixed with DNA ligase, placed in...

Embodiment 2

[0045] Soybean milk is obtained by removing impurities, washing, soaking, beating, removing slag, and then boiling to obtain soybean milk. The soybean milk is fermented with recombinant lactic acid bacteria, and the rest of the steps are the same as in Example 1.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a preparation method of a fermented beverage rich in soybean isoflavone aglycone. The preparation method comprises the following steps: 1) constructing recombinant lactic acid bacteria with high yield of beta-glucosidase; and 2) pretreating soybean-related raw materials, inoculating the recombinant lactic acid bacteria for fermentation, and performing sterilization and canning. According to the preparation method disclosed by the invention, the lactic acid bacteria are transformed by utilizing a genetic engineering technology, so that the blindness of a traditional technology is avoided, a large amount of screening and detection work is reduced, the recombinant lactic acid bacteria with high yield of beta-glucosidase are obtained, the lactic acid bacteria are promoted to produce a large amount of beta-glucosidase in the fermentation process, conversion of glycoside type soybean isoflavone to aglycone type soybean isoflavone is greatly promoted, and a new idea is provided for preparing a functional beverage rich in soybean isoflavone aglycone.

Description

technical field [0001] The invention belongs to the technical field of food and relates to a preparation method of a fermented beverage rich in soybean isoflavone aglycone. Background technique [0002] Soybean isoflavones are bisphenol secondary metabolites formed during the growth of legumes. Due to their similar structure and function to mammalian estrogen endogenous estradiol, they can interact with estrogen receptors to play a role To prevent menopausal women from cardiovascular disease and osteoporosis. In addition, soybean isoflavones also have various physiological activities such as anti-tumor, anti-oxidation, and lowering cholesterol. However, 97% to 98% of the isoflavones in soybeans exist in the form of conjugated glycosides. Due to their high molecular weight and strong hydrophilicity, glycoside-type soybean isoflavones cannot enter the blood through the small intestine wall and be effectively absorbed and utilized by the human body. After a deglycosylation re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): A23L11/65A23L11/50A23L33/00C12N1/21C12N15/56C12N15/74C12R1/01
CPCA23L11/65A23L11/50A23L33/00C12N9/2445C12Y302/01021C12N15/746A23V2002/00A23V2400/231A23V2200/30
Inventor 李笃信郭妍伍锦林芷芊张真庆
Owner SUZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap