Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of polypeptide PTPR in preparation of tumor immunotherapy medicine

An immunotherapy drug and tumor technology, applied in the field of biomedicine, can solve the problems of reducing the effect of immunotherapy, inactivation of tumor immune response, etc., to achieve the effect of inhibiting drug resistance, reducing abundance, and promoting tumor immune escape

Pending Publication Date: 2021-12-10
ZHEJIANG UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Highly expressed PD-L1 in tumor tissue binds to PD1 on the surface of immune cells, which inactivates the tumor immune response and reduces the effect of immunotherapy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of polypeptide PTPR in preparation of tumor immunotherapy medicine
  • Application of polypeptide PTPR in preparation of tumor immunotherapy medicine
  • Application of polypeptide PTPR in preparation of tumor immunotherapy medicine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1, PTPR peptide functional verification at the cellular level

[0035] 1. TMUB1 small molecule RNA inhibitor

[0036]According to the TMUB1 gene nucleotide sequence (Gene ID: 83590, http: / / sidirect2.rnai.jp / , the nucleotide sequence is shown in SEQ ID NO.2, the amino acid sequence is shown in SEQ ID NO.3), according to Based on the principle of complementary base pairing and the principle of minimum energy, two cholesterol-modified small molecule RNA nucleotide sequences are obtained, namely TMUB1 sequence 1 and TMUB1 sequence 2, which are TMUB1 small molecule RNA inhibitors.

[0037] TMUB1基因序列(SEQ ID NO.2):atga ccctgattgaaggggtgggt gatgaggtgaccgtcctttt ctcggtgctt gcctgccttc tggtgctggcccttgcctgg gtctcaacgc acaccgctgagggcggggac ccactgcccc agccgtcagggaccccaacg ccatcccagc ccagcgcagc catggcagctaccgacagca tgagaggggaggccccaggg gcagagaccc ccagcctgag acacagaggt caagctgcacagccagagcccagcacgggg ttcacagcaa caccgccagc cccggactcc ccgcaggagcccctcgtgctacggctgaaa ttcctcaatg attc...

Embodiment 2

[0053] Example 2. Design of TMUB1-competitive polypeptide PTPR and its entry into cells and its effect on PD-L1 expression.

[0054] 1. Using the principle of competitive inhibition to design TMUB1 competitive polypeptide PTPR

[0055] (1) Construction of TMUB1 truncated protein carrying Flag tag

[0056] TMUB1 protein (Wild Type) amino acid sequence composition ( image 3 Middle A): The 11th to 31st bits are TM1, the 32nd to 102nd bits are MU1, the 103rd to 176th bits are UBL, the 177th to 194th, 216th to 221st, and 242nd to 246th bits are MU2, the 195th to 215th bits are TM2, and the 222nd to 241st bits are TM3.

[0057] In view of the important regulatory role of TMUB1 protein (Wild Type) on the stability of PD-L1 and the characteristics of the amino acid sequence, we truncated part of the amino acid sequence in TMUB1 protein (Wild Type), as follows:

[0058] The nucleotide sequences translated MU1, UBL, MU2, and TM1 in TMUB1 were respectively truncated to obtain TMUB1 n...

Embodiment 3

[0068] Example 3. Using FITC-PTPR to weaken the immune escape of tumor cells to enhance the killing of tumor cells by T cells

[0069] Given the inhibitory effect of FITC-PTPR on PD-L1 stability at the cellular level, FITC-PTPR should have a significant inhibitory effect on tumor immune escape.

[0070] Human peripheral blood mononuclear cell PBMC were purchased from the American Standard Cell Culture Center (ATCC), using RMPI-1640 medium (Gibco) containing 10% FBS (Bovogen), 37 ° C, 5% CO 2 Cultured in an incubator, the MycoAlert kit (Lonza) detected that the cells had no mycoplasma contamination and no cross-contamination.

[0071] According to the instruction manual of human CD3 / CD28 / CD2 T cell activator (STEMCELL Technologies), PBMC were activated into cytotoxic T cells. The human breast cancer cell line MDA-MB-231 was inoculated into a 6-well plate with 3ml of FBS (Bovogen) DMEM / F12 medium containing 10% volume concentration in an amount of 2*10^5, 37°C, 5% CO 2 After ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of a polypeptide PTPR in preparation of a tumor immunotherapy drug, and particularly relates to a novel polypeptide designed by using a competitive inhibition principle on the basis of an amino acid sequence of a PD-L1 stability functional segment regulated by TMUB1. The polypeptide can enhance ubiquitination of the intracellular PD-L1 and promote degradation and removal of the PD-L1; by inhibiting stability regulation and control of TMUB1 to PD-L1, drug resistance of tumor cells to antibodies is inhibited, the problems that medication time is prolonged, the curative effect is reduced and the like are avoided, PD-L1 protein is induced to be degraded through proteasome so as to reduce the abundance of PD-L1 on the surfaces and inside the tumor cells, and the function of promoting tumor immune escape by the PD-L1 is fundamentally inhibited.

Description

technical field [0001] The invention relates to the technical field of biomedicine, in particular to a PTPR polypeptide drug for enhancing anti-tumor immunity of a body to realize tumor treatment. Background technique [0002] In addition to traditional surgical resection, radiotherapy, and chemotherapy, cancer treatment methods also include targeted drug therapy and immunotherapy. Although in recent years, anti-tumor immunotherapy based on immunosuppressant and other related molecules combined with the body's own immune system to treat cancer has achieved good results in various cancers, but tumor cells themselves respond through high expression of anti-tumor immune response. The combination of inhibitory molecules, such as PDL1, IDO and TGFβ, with various immunosuppressive molecule receptors (such as PD1, TIM3, LAG3, etc.) proliferation of. This is the bottleneck in anti-cancer immunotherapy. Therefore, the key to the current anti-immune therapy of cancer is to find new...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K38/10A61P35/00C07K7/08C07K1/107
CPCA61K38/10A61P35/00C07K7/08
Inventor 林爱福石成瑜
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com