Recombinant human growth hormone, and construction method and application thereof

A technology of human growth hormone and growth hormone, which is applied in the field of recombinant human growth hormone and its construction, can solve the problems of difficulty in prolonging the half-life of growth hormone, short half-life of natural growth hormone, and increasing the residence time of drugs to achieve efficient self-purification and efficient storage The effect of energy, high resilience

Pending Publication Date: 2022-01-04
JIANGSU UNIV
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

(2) Pharmaceutical-grade recombinant human growth hormone products have high requirements on purity, how to purify them efficiently and with high purity; (3) Natural growth hormone has a short half-life in vivo, and it is difficult to prolong the half-life of growth hormone and increase the residence time of drugs in tissues to achieve Long-acting to reduce dosing frequency

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant human growth hormone, and construction method and application thereof
  • Recombinant human growth hormone, and construction method and application thereof
  • Recombinant human growth hormone, and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1: Construction of recombinant expression plasmid pET30a(+)hGH-(EAAAK)5-RMP16

[0027] Sangon Bioengineering (Shanghai) Co., Ltd. Whole Gene Synthesis hGH-(EAAAK) 5 - RMP16, wherein, the nucleic acid sequence of hGH is shown in SEQ ID NO: 3; RMP16 is a resin-mimetic protein (resilin-mimetic protein), its amino acid sequence is shown in SEQ ID NO: 4, and the nucleotide sequence encoding RMP16 is shown in Shown in SEQ ID NO:5; linker (EAAAK) 5 is a connecting peptide, and its nucleic acid sequence is shown in SEQ ID NO:6.

[0028] SEQ ID NO: 3:

[0029]ATGGCTACAGGCTCCCGGACGTCCCTGCTCCTGGCTTTTGGCCTGCTCTGCCTGCCCTGGCTTCAAGAGGGCAGTGCCTTCCCAACCATTCCCTTATCCAGGCTTTTTGACAACGCTATGCTCCGCGCCCATCGTCTGCACCAGCTGGCCTTTGACACCTACCAGGAGTTTGAAGAAGCCTATATCCCAAAGGAACAGAAGTATTCATTCCTGCAGAACCCCCAGACCTCCCTCTGTTTCTCAGAGTCTATTCCGACACCCTCCAACAGGGAGGAAACACAACAGAAATCCAACCTAGAGCTGCTCCGCATCTCCCTGCTGCTCATCCAGTCGTGGCTGGAGCCCGTGCAGTTCCTCAGGAGTGTCTTCGCCAACAGCCTGGTGTACGGCGCCTCTGACAGCAACGTCTATGACCTCC...

Embodiment 2

[0054] Embodiment 2: expand the escherichia coli expressing hGH-(EAAAK) 5-RMP16

[0055] (1) Transfer freshly transformed recombinant Escherichia coli BL21 to solid LB medium with 50 μg / mL kanamycin (agar powder 15g / L, tryptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L, pH7.4), cultivate overnight at 37 ℃, and then transfer the single colony after overnight culture to 5ml liquid LB medium containing 50 μg / mL kanamycin (tryptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L, pH 7.4), and cultivated overnight at 37 ℃, 00 rpm orbital shaker, then inoculated 3 mL of overnight cultured E. coli BL21 in 300 mL containing 50 Grow the liquid LB medium of μg / mL kanamycin at 37 °C, 200 rpm for 3 hours or the OD600 of the bacteria reaches between 0.4-0.6.

[0056] (2) Place the liquid LB medium containing recombinant E. coli finally obtained in step (1) on ice for 20 minutes, and add isopropyl β-D-1-thiogalactopyranoside (IPTG) to it to a final concentration of 0.2 mM. Then, ...

Embodiment 3

[0059] Embodiment 3: cooling coagulation purification hGH-(EAAAK) 5-RMP16

[0060] In this embodiment, the cooling coagulation method is used to purify hGH-(EAAAK) 5 - RMP16, to verify the self-purification performance and purification efficiency of the hGH prepared in Example 2. The specific operation steps are:

[0061] Concentration of 0.4-1.0 M (NH 4 ) 2 SO 4 Add to 500 μL supernatant containing soluble protein, mix well, place on ice for 30-60 min, then centrifuge at 4 °C, 12000 rpm for 15 min, separate supernatant and precipitate, and resuspend the precipitate in Tris- HCl (50 mM, pH 8.0) buffer. Place the resuspended Tris-HCl buffer at 0°C for 1, 2, 12, and 24 hours, observe the coacervate that appears at different temperatures at different times, and absorb the coacervate, which is the target protein hGH-(EAAAK) 5 - RMP16. Transfer the coacervate to a new EP tube and save a portion of the purified sample for SDS-PAGE analysis.

[0062] figure 2 The SDS-PAGE g...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a recombinant human growth hormone, and a construction method and application thereof, and belongs to the technical field of bioengineering. In the recombinant human growth hormone, hGH and RMP16 are connected through a connecting peptide (EAAAK) 5 to construct the recombinant human growth hormone which is marked as hGH-(EAAAK) 5-RMP16; the recombinant human growth hormone can be expressed in an escherichia coli prokaryotic expression system and has a self-efficient purification capability; and meanwhile, the recombinant human growth hormone can improve the stability of the hGH, prolong the half-life period of the hGH and increase the in-vivo residence time of the hGH so as to reduce administration frequency.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and specifically relates to a recombinant human growth hormone and its construction method and application. Background technique [0002] With the continuous development of the economy and the continuous improvement of people's living standards, the problem of children's height has attracted increasing attention from society and families, and short stature has become one of the main diseases affecting children's physical and mental health. The etiology of short stature in children is relatively complex, mainly including growth hormone deficiency (growth hormone deficiency, GHD), idiopathic short stature (ISS), Turner syndrome (Turner syndrome, TS), growth hormone insufficiency Sensitivity or resistance syndrome, skeletal development disorder, intrauterine growth retardation, certain chronic diseases, malnutrition and growth retardation caused by other endocrine and metabolic diseases, etc....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/70C12N1/21C12P21/02C12R1/19
CPCC07K14/61C07K14/43563C12N15/70C07K2319/00
Inventor周阳刘岳霖王银峰张新爽高伏康高力陈东锋施海峰张轩榕
OwnerJIANGSU UNIV