Application of corn Zm00001d013367 gene to regulation and control of development and water transport of native xylem of
A xylem and gene technology, applied in the field of genetic engineering, can solve the problems that the regulatory mode has not been reported, the mechanism of the arrangement is unclear, and the relationship between the thickening mode of the secondary cell wall of the vessel and the water transport efficiency is poorly understood. Facilitates water transport and allows organ elongation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] biomaterials:
[0057] A mutant dos1( d rough- o verly- s aggressive 1 ). That is, the mutants came from the mutant library created by EMS mutagenizing the maize inbred line B73.
[0058] The vector pCM3300 used for the transgene was donated by Professor Guo Yan from China Agricultural University.
[0059] The dos1 mutant gene has not been confirmed before this application, that is, it is unknown which gene is mutated in the dos1 mutant.
[0060] The genome nucleotide sequence of the Zm00001d013367 gene (https: / / www.maizegdb.org / ) is shown in SEQ ID NO.1, and the amino acid sequence P001 of the protein encoded by T001 is shown in SEQ ID NO.2.
[0061] SEQ ID NO.1:
[0062] ATGAGGGAGTGCATCTCGATCCACATCGGCCAGGCTGGTATCCAGGTCGGAAACGCGTGCTGGGAGCTG TACTGCCTCGAGCATGGCATTCAG GTAACGAACCGTCCATTTCCACTCCTGTTCTCGCGTTGTTGAGGTAGATCTGTACGGATCTGTACCGTCACATACATGTAGATCTATAATCGGTATGGGGGGATTTCGTCGTTCATGTGTGCCTGATTTGGTGTGGCTGAATCGCGGAAGAAATGGTATTTCAGATCGTTAGATCTGTACGGATCTGCTTGTATGT...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


