Application of corn Zm00001d013367 gene to regulation and control of development and water transport of native xylem of

A xylem and gene technology, applied in the field of genetic engineering, can solve the problems that the regulatory mode has not been reported, the mechanism of the arrangement is unclear, and the relationship between the thickening mode of the secondary cell wall of the vessel and the water transport efficiency is poorly understood. Facilitates water transport and allows organ elongation

Active Publication Date: 2022-01-11
SANYA INST OF HENAN UNIV +1
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the reticulate or pore structure of metaxylem has ROP11 / MIDD1 / Kinesin-13A complex-mediated depolymerization of cortical microtubules to affect secondary cell wall deposition, the ring or helical structure of protoxylem has a regulatory mode No report
Microtubule-mediated deposition of cellulose, hemicellulose, and lignin has been described using live-cell imaging, but the mechanisms that guide microtubule arrays in specific orientations in different cell types remain unclear. Patterns of secondary cell wall thickening in relation to water transport efficiency remain poorly understood

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of corn Zm00001d013367 gene to regulation and control of development and water transport of native xylem of
  • Application of corn Zm00001d013367 gene to regulation and control of development and water transport of native xylem of
  • Application of corn Zm00001d013367 gene to regulation and control of development and water transport of native xylem of

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] biomaterials:

[0057] A mutant dos1( d rough- o verly- s aggressive 1 ). That is, the mutants came from the mutant library created by EMS mutagenizing the maize inbred line B73.

[0058] The vector pCM3300 used for the transgene was donated by Professor Guo Yan from China Agricultural University.

[0059] The dos1 mutant gene has not been confirmed before this application, that is, it is unknown which gene is mutated in the dos1 mutant.

[0060] The genome nucleotide sequence of the Zm00001d013367 gene (https: / / www.maizegdb.org / ) is shown in SEQ ID NO.1, and the amino acid sequence P001 of the protein encoded by T001 is shown in SEQ ID NO.2.

[0061] SEQ ID NO.1:

[0062] ATGAGGGAGTGCATCTCGATCCACATCGGCCAGGCTGGTATCCAGGTCGGAAACGCGTGCTGGGAGCTG TACTGCCTCGAGCATGGCATTCAG GTAACGAACCGTCCATTTCCACTCCTGTTCTCGCGTTGTTGAGGTAGATCTGTACGGATCTGTACCGTCACATACATGTAGATCTATAATCGGTATGGGGGGATTTCGTCGTTCATGTGTGCCTGATTTGGTGTGGCTGAATCGCGGAAGAAATGGTATTTCAGATCGTTAGATCTGTACGGATCTGCTTGTATGT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of gene engineering, and particularly discloses an application of a corn Zm00001d013367 gene to regulation and control of development and water transport of native xylem. The nucleotide sequence of the Zm00001d013367 gene is shown as SEQ ID NO.1, the amino acid sequence of a protein coded by the Zm00001d013367 gene is shown as SEQ ID NO.2, and the Zm00001d013367 gene is used for regulating and controlling a secondary cell wall deposition process in the development process of the native xylem of the corn. The Zm00001d013367 gene disclosed by the invention is used for regulating and controlling the development and the water transport of the native xylem.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to the application of the corn Zm00001d013367 gene in regulating the development of protoxylem and its water transport. Background technique [0002] transpiration water loss, photosynthetic CO 2 Processes such as assimilation consume a large amount of water in plants, especially leaves, and the water in leaves is mainly supplied through processes such as root absorption and xylem transport. Xylem development and its pattern of vessel secondary wall thickening are critical for the efficient transport of water in plants. Xylem is a special organizational structure evolved by terrestrial plants to adapt to the long-distance transportation of water and nutrients. Its most notable feature is that it is formed by the deposition of cellulose, hemicellulose and lignin between the primary wall and the plasma membrane. Empty tubes of annular, helical, reticular, or pore-like se...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/82A01H5/00A01H6/46C12N15/29C07K14/415
CPCC12N15/8261C07K14/415Y02A40/146
Inventor宋纯鹏黄世全郭思义密玲煜李文娆李保珠赵津禾
OwnerSANYA INST OF HENAN UNIV