Chloroplast transport peptide Lsa3084 derived from lettuce and application of chloroplast transport peptide Lsa3084
A technology for transporting peptides and chloroplasts, which is applied in the field of chloroplast transporting peptide Lsa3084 and its applications, and can solve problems such as lack of sequence motifs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0056] The preparation method of the 2YT culture solution in the following examples is as follows: First, mix 16 g of tryptone, 10 g of yeast extract, 5 g of NaCl and 1 L of distilled water, then sterilize at 121 ° C for 20 min, then cool to room temperature for use, and store at 4 ℃ refrigerator.
[0057] The preparation method of the enzymolysis solution in the following examples is as follows: first mix the following components: 1.25% celluaseR10 0.1875g, 0.3% macerozyme R10 0.045g, 0.4M mannitol 7.5ml, 20mM KCl 1.5ml, 20mM MES (pH5 .7) 1.5ml, then 55 ℃ water bath for 10min, then cool to room temperature, add 0.15ml of 10mM CaCl2 and 0.015g of 0.1% BSA, and finally make up the total volume to 15ml with water.
Embodiment 1
[0058] Cloning of embodiment 1, Lsa3084 transit peptide
[0059] 1. Extraction of total RNA
[0060] Take 100mg of January lettuce seedlings as the experimental material, and use Novizyme RNA extraction kit (RC401) to extract total RNA.
[0061] 2. Acquisition of cDNA
[0062] The total RNA extracted in step 1 was reverse-transcribed into cDNA using Novizan Reverse Transcription Kit (R312).
[0063] 3. PCR amplification
[0064] Using the cDNA obtained in step 2 as a template, PCR amplification was performed using M-3084-F and M-3084-R primers to obtain a PCR product. The primer sequences are as follows:
[0065] M-3084-F: GC TCTAGA ATGGCGGCGGCGGCCTCTTCTT (the underlined sequence is the XbaI restriction site);
[0066] M-3084-R: ACGC GTC GAC GCCATCGTCTTTCTTGGTGAAGCAA (the underlined sequence is the SalI restriction site).
[0067] The PCR amplification system (total volume is 50 μl) is as follows: cDNA 3 μl, M-3084-F (10 μM) 2 μl, M-3084-R (10 μM) 2 μl, ddH 2 O 18 μ...
Embodiment 2
[0071] Example 2, Application of Lsa3084 Transit Peptide in Positioning Target Protein in Chloroplast
[0072] 1. Construction of the carrier
[0074] Use XbaI enzyme and SalI enzyme to cut the transit peptide fragment obtained in Example 1 and the carrier pYBA1132 (purchased from Shanghai Hewu Biotechnology Co., Ltd., product number is P8514), and then recover the cut products to obtain the fragments after digestion product.
[0075] The enzyme digestion system (total volume: 50 μl) is as follows: 1 μl of XbaI enzyme and SalI enzyme, 5 μl of cutsmart, and 43 μl of nucleic acid fragments.
[0076] The enzyme digestion reaction program was 37°C for 2h and 65°C for 20min.
[0077] 2. Connection
[0078] Use T4 ligase to ligate the fragments of the digested products obtained in step 1 to obtain a recombinant vector.
[0079] The ligation reaction system (total volume 10 μl) is as follows: T4 ligase 0.5 μl, T4 buffer 1 μl, transit peptide fragment...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More