Unlock instant, AI-driven research and patent intelligence for your innovation.

Primer group, kit and method for identifying poisonous mushroom Amanita concentrica

A technology of primer sets and kits, applied in biochemical equipment and methods, recombinant DNA technology, and resistance to vector-borne diseases, etc., can solve problems such as less attention and research, difficult morphological identification, life safety and health risks, etc. To achieve the effect of strong detection specificity

Active Publication Date: 2022-02-18
CHINESE ACAD OF INSPECTION & QUARANTINE
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In the first aid of poisonous mushrooms eaten by mistake, there are thorny problems such as sudden accidents and difficult morphological identification. At present, there is little attention and research on toxic biological hazards in my country, and mature detection and identification methods, reagents and standards have not been formed, and timely diagnosis cannot be made. The cause of poisoning, or even misdiagnosis, has brought major hidden dangers to people's life safety and health.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer group, kit and method for identifying poisonous mushroom Amanita concentrica
  • Primer group, kit and method for identifying poisonous mushroom Amanita concentrica
  • Primer group, kit and method for identifying poisonous mushroom Amanita concentrica

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1. Design of primers and probes

[0049] 1. Select the mushrooms to be tested

[0050] Mushroom samples for testing: wet samples were stored at -20°C, dry samples were stored at room temperature, and the mushroom samples used for testing are shown in Table 1.

[0051] Table 1 Types of mushroom samples tested

[0052]

[0053] 2. Design of specific primers for the poisonous mushroom Amanita amanita

[0054] DNA analysis of the ITS genes of seven kinds of mushrooms: Amanita chinensis, Amanita false brown cloud, Light red Amanita, Russula spp. Sequencing, the sequences are shown in SEQ ID NO.5~NO.11 in turn, combined with the BOLD system to retrieve the genome ribosome sequences of all tested mushrooms.

[0055]The obtained sequences were compared with DNAMAN software (a highly integrated molecular biology comprehensive application software developed by LynnonBiosoft, U.S.A.) to find the sites that can specifically distinguish the poisonous mushroom Amanitati...

Embodiment 2

[0059] Example 2. Primer specificity and sensitivity verification

[0060] (1) DNA extraction

[0061] Genomic DNA was extracted from the mushroom samples in Table 1 using the "Plant Genomic DNA Extraction Kit" (purchased from Beijing Suolaibao Technology Co., Ltd.) for the specificity verification of the primers. For the specific operation process, refer to the instructions of the DNA extraction kit.

[0062] (2) Primer specificity verification:

[0063] Using the DNA extracted in step (1) as a template, PCR amplification was performed using the primers in Table 2 (amplification reagent 2×TaqPCR MasterMix was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd., Cat. No. KT201), and by continuously adjusting the PCR reaction Reagent dosage and annealing temperature, time, etc. determine the final reaction system.

[0064]

[0065] After the amplification reaction is over, take 5 μl of PCR-specific amplification products and perform electrophoresis detection ...

Embodiment 3

[0071] Example 3. Real-time fluorescent PCR identification of poisonous mushroom Amanita ringscale

[0072] According to the method of embodiment 2, extract the genomic DNA of Amanita ring scale as real-time fluorescent PCR amplification template, and extract the genomic DNA of other mushroom species as contrast, with ddH 2 O is a negative control, and a real-time fluorescent PCR reaction was carried out using the Taqman fluorescent probe method.

[0073] The qPCR reaction system is: a total volume of 20 μl, including 10 μl of 2×T5 Fast qPCR Mix (Beijing Qingke Biotechnology Co., Ltd., Cat. No. TSE301), 1 μl of primers AconF / qAconR at a concentration of 10 μM, and 0.5 μl of probe AconU at a concentration of 10 μM , DNA template 1μl, the balance is ddH 2 O. The qPCR amplification program was: 95°C for 10min; 95°C for 10s, 60°C for 40s, 40 cycles; and finally cooling at 40°C for 30s.

[0074] The result is as image 3 As shown, the real-time fluorescent PCR amplification was...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer group, a kit and a method for identifying poisonous mushroom Amanita concentrica, the primer group comprises a primer AconF and a primer qAconR, the nucleotide sequences of the primer AconF and the primer qAconR are as follows: AconF: GTCTCTCTTCTTGCTTGTTTC, and qAconR: AAATCCAAAACACACTCAAAAAGAGC; the identification method comprises the following steps: 1) extracting genome DNA of a sample to be detected; 2) carrying out PCR amplification on the extracted genome DNA by adopting the primer group or the kit; and 3) detecting whether the PCR amplification product contains a target amplification fragment, and identifying the sample containing the target amplification fragment as the Amanita concentrica. The invention establishes a poisonous mushroom Amanita concentrica rapid identification technical system with wide applicability, innovates the detection means and measures, and realizes rapid identification of toxic mushroom.

Description

technical field [0001] The invention relates to the technical field of mushroom germplasm identification, in particular to a primer set, a kit and a method for identification of poisonous mushroom Amanita amanita. Background technique [0002] Some poisonous fungi and edible fungi are similar in appearance, and have the same growth season and growth environment. They grow together and are easy to be used as edible fungi. Eating wild poisonous mushrooms by mistake may cause serious consequences such as acute liver damage, acute kidney failure, and gastroenteritis. [0003] Among the common wild poisonous mushrooms, some fungi of the genus Amanita (Amanitaceae) are toxic because they contain amanita peptide toxins, such as Amanita concentrica, which is recorded in the Ministry of Ecology and Environment of China It is included in the list of "China Biodiversity Red List - Large Fungus Volume" issued by the Academy of Sciences, and has been evaluated as DD level. [0004] In ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12Q1/686C12Q1/04C12N15/11
CPCC12Q1/6895C12Q1/686C12Q2600/166C12Q2563/107C12Q2545/113C12Q2565/125Y02A50/30
Inventor 张玉姜帆朱水芳石俊霞王超楠
Owner CHINESE ACAD OF INSPECTION & QUARANTINE