31 results about "Amanita" patented technology

The present invention relates to compositions and methods comprising genes and peptides associated with cyclic peptide toxins and toxin production in mushrooms. In particular, the present invention relates to using genes and proteins from Amanita species encoding Amanita peptides, specifically relating to amatoxins and phallotoxins. In a preferred embodiment, the present invention also relates to methods for detecting Amanita peptide toxin genes for identifying Amanita peptide-producing mushrooms and for diagnosing suspected cases of mushroom poisoning. Further, the present inventions relate to providing kits for diagnosing and monitoring suspected cases of mushroom poisoning in patients.

The invention provides russula vinosa Lindbl yield increasing fungi and a using method thereof, which belong to the technical field of russula vinosa Lindbl yield increase and solve the problems of low yield, high price, low quality and the like of wild russula vinosa Lindbl of the prior art. The russula vinosa Lindbl yield increasing fungi of the invention are a mixed flora of locally common ectomycorrhizal fungi and comprise Boletus brunneissimus Chiu, R. albida Peck, Boletus luridus and amanita yellow corner. Mycelia of various fungi of the russula vinosa Lindbl yield increasing fungi are cultured by a shaker culture method respectively; the mycelia are separate and used to prepare mycelium mixtures at a concentration of 50mg/L respectively; the mixtures are mixed uniformed in the same amount before inoculation to form the russula vinosa Lindbl yield increasing fungi; and on a woodland wherein russula vinosa Lindbl grows, the russula vinosa Lindbl yield increasing fungi are inoculated in dent pits by a root cutting and mycorrhization technique. In the method, ectomycorrhizal fungi flora is used to increase the biomass of thin roots of arbor, so the fruiting capacity, yield and quality of wild russula vinosa Lindbl are improved obviously and remarkable economic benefits are created. Thus, the method is suitable to be promoted and used in large areas.

The method relates to a culturing method for promoting growth of Amanitaflavipes mycelia, belonging to the technical field of culturing of macro fungi.. The culturing method is characterized in that mycelia are induced with mature sporocarps without pileus and a culturing medium is improved so as to provide a simple optimized culturing medium with short culturing circle, low cost and capability of promoting the fast growth of mycelia. Amanita belongs to special and precious economical macro fungi, is high in value and wide in application range and has potential application prospect in the field of development of new specific medicines such as anti-tumor, antibacterial and antiviral, sedative or narcotic medicines, but Amanita is hard to develop and use so far because of rear resource, difficulty in artificial acclimatization, inactive chemical synthetics of toxins and other problems. According to the method, Amanitaflavipes mycelia collected from Shishan, Wuding, Yunnan is used as the raw material and innovative breakthrough is made aiming at the problems limiting the culturing, such as difficulty in mycelium induction and slow growth of mycelia, thereby providing conditions for large-scale culturing and artificial acclimatization of Amanitaflavipes mycelia in the further.

The invention relates to an establishing method for indoor symbiotic relationship of amanita flavipes and cyclobalanopsis glaucoides which is a symbiotic plant, and belongs to the field of biotechnology (plant tissues and Fungus cultivation). An overwhelming majority of amanita belongs to ectomycorrhizal fungi, can not be yet subjected to artificial cultivation at present, and can be hardly developped and utilized; and growth and development of sporocarps of the amanita has a close relationship with cyclobalanopsis glaucoids which is a symbiotic plant. The establishing method is characterizedin that myceliums are induced through the sporocarps of amanita flavipes for reproduction; aseptic seedlings and potted seedlings are successfully obtained by using seeds of cyclobalanopsis glaucoides, collected in the field; reproduced myceliums are inoculated to the roots of the aseptic seedlings and the potted seedlings respectively; the result shows that inoculated seedlings are more exuberant than the non-inoculated seedlings and have more leaves, the leaves of inoculated seedlings are dark green, disease resistance of inoculated seedlings are reinforced; and therefore, the indoor symbiotic relationship of amanita flavipes and cyclobalanopsis glaucoides is innovatively established, and a technological reserve is provided for future researches on symbiotic mechanism and mechanism generated in the sporocarps of amanita.

The invention relates to a method for co-culturing an amanita subfrostiana mycelium by using a mycorrhizal fungus and a saprobic fungus, and belongs to the technical field of macro fungus culture. The method is characterized in that the mycorrhizal fungus lactarius piperatus and the artificially cultured saprobic fungus lentinus edodes are added directly in multiplication media, so that the growth rate of the amanita subfrostiana mycelium can be increased by 9-12 times, and the growth is accelerated obviously. According to the method, a tedious and complex process is not required, the reproduction speed of the mycelium can be increased only by adding a mixture of the two fungi into the media, the effect is obvious, the culture is simple and easy to implement, and the production cost is low. Amanita toxins have potential application in the field of development of novel specific medicines such as anti-tumor medicines, anti-microbial and antiviral medicines, sedative or anaesthetic medicines and like, while are difficult to develop and apply due to bottleneck problems that resources are rare and valuable, artificial acclimation is difficult and the like. The method performs innovation research aiming at pure culture restraining problems such as slower growth of the amanita subfrostiana mycelium and the like, and provides a basis for large-scale culture, artificial acclimation and culture in the future and the like of the mycelium.

The invention relates to a solid-liquid alternating culturing method for mycelia of amanita rubrovolvata imai and belongs to the technical field of culturing of macro fungi. The solid-liquid alternating culturing method for mycelia of amanita rubrovolvata imai is characterized by comprising the steps of: performing solid culturing on the induced and propagated mycelia for 4-6 generations and then performing the liquid culturing on the induced and propagated mycelia for 3-4 generations by using the solid-liquid alternating culturing method; then performing the solid culturing, wherein the growth speed of the mycelia is 8-10 times that of the mycelia before the liquid culturing, and the growth is speeded obviously. According to the invention, the propagation speed of the mycelia is speeded up by simply changing the culturing method, the operation is simple and easy to implement, the effect is obvious, and the production cost is low. The toxin of the amanita has potential application in the field of developing new specific medicines such as antineoplastic medicines, antibiosis and antiviral medicines, sedatives or narcotics, but is different to develop and apply due to the bottleneck problems such as the valuable and rare resource and the difficulty in artificial acclimatization so far. According to the invention, focused research is performed on the problems for limiting the pure culturing such as very slow growth of the mycelia of amanita rubrovolvata imai, and conditions are provided to the large-scale culturing of the mycelia, the artificial acclimatization cultivation in future and the like.

The invention discloses a special culture medium for Chinese amanita. The special culture medium is prepared from the following raw materials in parts by weight: 5-10 parts of black bean peels, 5-10 parts of maidenhair tree sawdust, 3-5 parts of rhizoma dioscoreae starch, 5-8 parts of red raspberries, 4-8 parts of blackberry marc, 2-5 parts of spirulina powder, 3-8 parts of bamboo shoot leaves, 2-5 parts of horseradish tree leaves, 2-5 parts of corn silks, 1-3 parts of fructus lycii, 0.1-1 part of folic acid, 0.05-0.2 part of vitamin B12, 2-4 parts of gypsum and 1-3 parts of lime. Through synergistic effect exerted by compounding various raw materials, the special culture medium for the Chinese amanita provided by the invention has higher nutritive value and increases the nutrition contentof a product and is simple in preparation method, available in raw materials and liable to realize. By adopting the special culture medium for the Chinese amanita, a great quantity of reproductive mycelium of the Chinese amanita can be acquired, and the demand on mass production can be met.

The invention provides a cyclomonomer having actin-binding activity. The cyclomonomer is of utility for the study of the molecular biology of actin polymerization. The cyclomonomer is also useful for the study of and treatment of the toxic effects of Amanita sp. poisoning.

The invention provides a preparation method of an Alpha-amanita hemolysin molecular imprinting material, and relates to the field of a separation material. The method comprises the following steps of S1, uniformly mixing a template molecule, a functional monomer, a cross-linking agent and a solvent; S2, performing sulfhydrylation treatment on the carrier surface; S3, adding a carrier obtained through the treatment in the S2 into a mixed solution prepared in the S1, and performing cross-linking polymerization with the functional monomer; S4, eluting the template molecule from the polymerized carrier surface; S5, performing vacuum drying on the molecular imprinting material obtained through treatment in the S4. The preparation method has the advantages that the experiment operation is simple and convenient; nitrogen introduction and oxygen removal are not needed; the reaction can be triggered by regulating the pH value of a reaction system by triethylamine; the reaction condition is mild; the time is short; the method shows great superiority than that of a traditional molecular imprinting preparation method.

The invention relates to the technical field of food quality and safety detection, and particularly discloses an amanita species identification method based on DNA mini-barcode and application. The method comprises the following steps: extracting toxic amanita genome DNA, then carrying out PCR amplification by utilizing self-designed DNA mini-barcode primers, sequencing a purified PCR product, comparing a DNA mini-barcode fragment sequence obtained by sequencing with a reference sequence in a public database, and carrying out species identification according to the matching similarity of the sequences. The method is simple and convenient to operate and high in accuracy, can identify an artificially simulated digested amanita sample, and has great application potential in analysis of amanita or vomit after mistaken eating and other scenes.

The invention discloses a composition for preventing and controlling diseases and insect pests of atractylodes macrocephala and application of the composition. The composition is prepared from the following components in percentage by mass: 20 percent to 30 percent of macleaya cordata fruit pod juice, 20 percent to 30 percent of amanita phalloides juice and 40 percent to 50 percent of phytolacca americana fruit juice. The composition disclosed by the invention is prepared through preparing the macleaya cordata fruit pod juice, the amanita phalloides juice and the phytolacca americana fruit juice respectively and then mixing according to a certain ratio. The composition provided by the invention has the advantages simple preparation technology and low cost, and has remarkable prevention andcontrol effects on the diseases and insect pests of the atractylodes macrocephala.

The present invention is related to novel cytotoxic agents, derivatives of Amanita toxins of Formula (I), wherein , - - - , R₁, R₂, R₃, R₄, R₅, R₆, R₇, R₈, R₉, R₁₀, X, L, m, n and Q are defined herein, the preparation and the therapeutic uses in the targeted treatment of cancers, autoimmune disorders, and infectious diseases.

The invention discloses a primer group, a kit and a method for identifying poisonous mushroom Amanita concentrica, the primer group comprises a primer AconF and a primer qAconR, the nucleotide sequences of the primer AconF and the primer qAconR are as follows: AconF: GTCTCTCTTCTTGCTTGTTTC, and qAconR: AAATCCAAAACACACTCAAAAAGAGC; the identification method comprises the following steps: 1) extracting genome DNA of a sample to be detected; 2) carrying out PCR amplification on the extracted genome DNA by adopting the primer group or the kit; and 3) detecting whether the PCR amplification product contains a target amplification fragment, and identifying the sample containing the target amplification fragment as the Amanita concentrica. The invention establishes a poisonous mushroom Amanita concentrica rapid identification technical system with wide applicability, innovates the detection means and measures, and realizes rapid identification of toxic mushroom.

The invention relates to the technical field of detection, in particular to a non-disease-diagnosis amanita peptide detection method. The detection method comprises the operation of detecting amatoxin in a to-be-detected sample, wherein the to-be-detected sample is prepared by performing protein degradation treatment on the to-be-detected sample. A to-be-detected sample used in the detection method is prepared after the to-be-detected sample is subjected to protein degradation treatment, and protein in the protein binding state amatoxin can be degraded through the protein degradation treatment, so that more free state amatoxin is released. Therefore, the free amatoxin contained in the used sample to be detected is composed of the original free amatoxin and the free amatoxin released by the protein binding state amatoxin, that is, the detection method disclosed by the invention can be used for simultaneously detecting the free amatoxin and the protein binding state amatoxin contained in the sample to be detected; therefore, the detection window period of the amatoxin can be obviously prolonged, and the detection rate of the amatoxin is effectively increased.

The invention relates to the technical field of molecular identification, in particular to a primer group and a kit for identifying Gyromitra infusus and application of the primer group and the kit. The primer group provided by the invention can specifically amplify the nucleic acid of the deer antler, and does not have cross reaction with the nucleic acid of the white beveled fungus, the deer antler, the morchella, the bodybell fungus, the brown tray verruca and the beveled beveled fungus which are easy to confuse, and the nucleic acid of other macro fungi such as the boletus amber, the choriomyelon, the amanita coleopleatus and the boletus mucilaginosus, so that the nucleic acid of the deer antler and the nucleic acid of the boletus mucilaginosus are not subjected to cross reaction; the specificity is strong, and the primer group can be used for identifying the ochracea ochracea. Furthermore, according to the identification method provided by the invention, the specific identification of the deer antler can be completed within 90 minutes by utilizing the primer group, the detection result can be directly observed by naked eyes, and the method has the advantages that the operation is simple, the sensitivity is high (the detection limit is 1ng/mu L), the method is suitable for a base layer, and the field detection can be realized.