Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

MATE family gene and application of encoding protein thereof in enhancing paraquat resistance of plants

A technology of paraquat and plants, applied in the biological field, can solve problems such as the mechanism of action is not very clear

Pending Publication Date: 2022-02-25
UNIV OF SCI & TECH OF CHINA
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, although there have been some reports on plant paraquat tolerance, its mechanism of action is still not very clear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • MATE family gene and application of encoding protein thereof in enhancing paraquat resistance of plants
  • MATE family gene and application of encoding protein thereof in enhancing paraquat resistance of plants
  • MATE family gene and application of encoding protein thereof in enhancing paraquat resistance of plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Example 1 Acquisition and gene mapping of Arabidopsis thaliana paraquat-tolerant mutant pqt15-5

[0064] Arabidopsis wild-type (Col-0 ecotype) seeds (purchased from Arabidopsis Biological Resource Center (Arabidopsis Biological Resource Center, referred to as, ABRC)) were mutagenized by ethyl methylsulfonate (EMS) , creating the M2 generation Arabidopsis mutagenesis mutant library (refer to the EMS mutagenesis method of Arabidopsis thaliana of Zhu Jianjian's research group, see YongSig Kim, K.S.S., and Jian-Kang Zhu (2005). "EMS-Mutagenesis-of-Arabidopsis. " Methods in Molecular Biology 323.). MS (Murashige and Skoog) solid medium containing 2uM paraquat (otherwise containing 0.6% agar powder, 1% sucrose, pH=5.8, sterilized by high-temperature steam, cooled to 50-60°C, and added aseptically treated paraquat Mother liquor) was used as a condition to screen paraquat-tolerant mutants. The aseptically treated and vernalized M2 generation seeds were spread evenly on M...

Embodiment 2

[0076] Example 2 Arabidopsis thaliana AtDTX6 / dtx6-D gene can enhance the tolerance of Escherichia coli rosetta strains to paraquat

[0077] Firstly, primers for amplification of AtDTX6 / dtx6-D gene fragments were designed according to the T4 junction system, the mRNAs of Col-0 and pqt15-5 strains were extracted and reverse-transcribed into cDNA, and the AtDTX6 / dtx6-D gene coding was amplified using the cDNA as a template Sequence CDS. Use T4 ligase to connect the AtDTX6 / dtx6-D gene fragments into the pET28a vector (purchased from Miaoling Biological Co., Ltd.), and respectively introduce the pET28a, pET28a-AtDTX6 and pET28a-dtx6-D plasmids into Escherichia coli rosetta strain (purchased from Beijing Huayueyang Biotechnology Co., Ltd.), rosetta strain containing pET28a plasmid (purchased from Beijing Huayueyang Co., Ltd.) was used as an empty control, positive single clones were picked, and the bacteria were shaken until OD=0.4-0.6 , point the bacterial solution on LB solid med...

Embodiment 3

[0095] Example 3 Arabidopsis AtDTX6 Gene Knockout and Overexpression Strains Obtained

[0096] AtDTX6 gene knockout strains were obtained: using CRISPR-Cas9 gene editing technology, gene editing target primers were designed according to the AtDTX6 gene coding sequence for Target I (AtDTX6-target1-FP: ATTGGTCTTAAGCCGACGCCGACA (SEQ ID NO: 7), AtDTX6-target1 - RP: AAAC TGTCGGCGTCGGCTTAAGAC (SEQ ID NO: 8)) and Target II (AtDTX6-target2-FP: ATTG GCTCAAGAACCTCAGCCGCA (SEQ ID NO: 9), AtDTX6-target2-RP: AAAC TGCGGCTGAGGTTCTTGAGC (SEQ ID NO: 10)), and Refer to the gene editing system of Xie Qi's research group to construct the pYAO-based CRISPR / Cas9 gene editing vector. The constructed gene editing vector was electrotransfected into C58C1 Agrobacterium (the strain was donated by Professor Oliver D.J. of ISU University in the United States), and transformed into wild-type Arabidopsis thaliana using the method of Agrobacterium soaking flower transformation, and the T0 generation seeds we...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a gene related to paraquat resistance and an application of a coding protein AT2G04100 / AtDTX6. Experiments show that the AtDTX6 gene involved in the invention is a member of the MATE gene family, the AtDTX6 gene encodes a class of efflux transporter proteins, and the high expression of the proteins can significantly improve the resistance of plants to paraquat; in addition, the 311th site of the amino acid sequence of the protein is mutated from glycine to glutamic acid (G331E), so that the function of the protein can be remarkably enhanced, and the resistance of arabidopsis thaliana to paraquat is remarkably improved. The gene sequence comparative analysis finds that homologous genes exist in multiple crops such as rice, corn, cotton, tomato and grape, it can be considered that the paraquat resistance of different crops is improved through a transgenic technology and a gene editing technology, and a new thought and a theoretical basis can be provided for cultivation of new paraquat-resistant crop varieties.

Description

technical field [0001] The invention belongs to the field of biotechnology, and particularly relates to the application of a class of MATE efflux type transporter family genes and encoded proteins in enhancing plant resistance to paraquat. Background technique [0002] Arabidopsis thaliana, a dicotyledonous plant and a cruciferous plant, is mainly distributed in Europe, Asia and North America. Arabidopsis thaliana is widely used as a model plant in the field of plant science because of its small genome, short growth cycle, high fruit size and easy artificial cultivation. The study of this model plant can provide a theoretical basis for cultivating the excellent traits of other crops. [0003] Paraquat (PQ for short), also known as methyl viologen (MV), is a good broad-spectrum contact non-selective herbicide. Paraquat can quickly and effectively kill hundreds of weeds. It is easy to passivate quickly and leave no residue when it meets the soil. It mainly destroys the photo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82A01H5/00A01H6/20
CPCC07K14/415C12N15/8274
Inventor 向成斌夏金球
Owner UNIV OF SCI & TECH OF CHINA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com