Garlic purple acid phosphatase AsPAP gene and application thereof in improving content of alliin in garlic callus
A technology of acid phosphatase and garlic, applied in application, genetic engineering, plant genetic improvement, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Example 1. Bioinformatics analysis of garlic stress-related purple acid phosphatase AsPAP gene
[0034] In the previous research of the project team, using Pizhou purple garlic as the test material, the second-generation high-throughput sequencing RNA-seq method was used to analyze the transcriptome in response to pinch stress. It was found that a differentially expressed gene expressed a protein with the characteristics of purple acid phosphatase, located in Garlic chromosome 5, the gene named AsPAP. Taking the whole genome sequence of Allium sativum in NCBI as a reference, 3000 bp (chr5: 63512838--63541926) before and after the reference sequence (chr5: 63515838--63538926) were intercepted, and a total of 29089 bp nucleotide sequence was used as the research object. Bioinformatics software analyzes the AsPAP gene, the main contents are as follows:
[0035] (1) CD-search search for the conserved domain of AsPAP protein;
[0036](2) Protparam analyzes the basic physic...
Embodiment 2
[0057] Example 2 Analysis of the expression characteristics of AsPAP gene
[0058] Expression of AsPAP gene under pinch stress
[0059] Pizhou large white garlic variety PZ1 garlic cloves were used as seeds and planted in the greenhouse. After the garlic leaves grew to the second-leaf stage, the garlic leaves were pinched with sterile tweezers, and the leaf tissues were taken at 0h, 3h, 6h and 12h after the pinch. Each treatment was replicated three times. Total plant RNA was extracted using a plant RNA extraction kit, and cDNA was synthesized by reverse transcription using a reverse transcription kit. Real-time PCR method was used to analyze the expression level of AsPAP gene. The result is as figure 2 As shown, under the garlic leaf pinch stress, the expression of AsPAP gene was significantly up-regulated, reached the highest after 3 hours, increased by about 2.76 times, and then the expression decreased.
Embodiment 3
[0060] Example 3 Cloning of full-length cDNA of AsPAP gene and construction of plant binary expression vector
[0061] Total RNA was extracted from garlic seedlings, and cDNA was obtained by reverse transcription.
[0062] Based on the AsPAP gene predicted by transcriptome sequencing results, the full-length sequence was used as a template to design and amplify the full-length expression reading frame sequence, and the primer sequence was
[0063] AsPAP-F (SEQ ID NO.1):
[0064] ATCACCAGTCTCTCTCTCAAGCTTATGGATCTTCGATTAATCATCATACT
[0065] AsPAP-R (SEQ ID NO.2):
[0066] CTCGCCCTTGCTCACCATAAGCTTGGACACCACAGTCAGAATCTTTCT
[0067] Using cDNA as a template and AsPAP-F and AsPAP-R as primers, the complete expression reading frame sequence of AsPAP was amplified. Use 1% agarose gel for electrophoresis, and cut the gel to recover the target fragment size sequence. The target fragment was cloned into the Hind III site of pHB-GFP using a one-step gene cloning kit. The colony PCR me...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Relative molecular mass | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More