Kit for CYP3A5 polymorphic site genotyping detection and detection method thereof

A technology of polymorphic sites and genotyping, applied in biochemical equipment and methods, recombinant DNA technology, microbial measurement/testing, etc., can solve problems such as non-specific amplification, improve specificity, and speed up experiments Accurate, reduce background signal noise effect

Pending Publication Date: 2022-03-15
HANGZHOU KMB BIOTECH
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The object of the present invention is to provide a method for CYP3A5 polymorphism in order to solve the problems of probe hydrolysis or ARMS-PCR, which have strict requirements on primer design region sequences

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for CYP3A5 polymorphic site genotyping detection and detection method thereof
  • Kit for CYP3A5 polymorphic site genotyping detection and detection method thereof
  • Kit for CYP3A5 polymorphic site genotyping detection and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0037] According to the genotyping detection of CYP3A5 (rs776746) polymorphism site, the target region with design is obtained through bioinformatics tools, and the specific sequence is as follows:

[0038]agtccttgtg agcacttgat gatttacctg ccttcaattt ttcactgacc taatattctttttgataatg aagtatttta aacatataaa acattatgga gagtggcata ggagataccc acgtatgtaccacccagctt aacgaatgct ctactgtcat ttctaaccat aatctcttta aagagctcttttgtctttcartatctcttcc ctgtttggac cacattaccc ttcatcatat gaagccttgggtggctcctgtgtgagactc ttgctgtgtg tcacacccta atgaactaga acctaaggtt gctgtgtgtc(SEQ ID NO:9)。

[0039] The sequence is designed by using the design software, and the sequence is modified according to the experimental plan, as follows:

[0040] Wild-type detection sequence 1: FAM-atgccaggtaagagctcttttgtctttcargtxactcttccct-MGB (SEQ ID NO: 1);

[0041] Wild type detection sequence 2:

[0042]

[0043] Wild-type probe sequence: FAM-tgtctttgagtatctctccct-MGB (SEQ ID NO: 3);

[0044] Mutant detection sequence 1...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a kit for CYP3A5 polymorphic site genotyping detection and a detection method thereof. The kit comprises a wild type detection sequence 1, a wild type detection sequence 2, a mutant type detection sequence 1 and a mutant type detection sequence 2. According to the invention, a primer binding sequence and a probe binding sequence are integrated together, and the quenching effect is not ideal, so that double quenching groups are introduced in the design process of the sequences, the reaction sensitivity is improved, and the background signal noise is reduced; in order to improve the specificity of hybridization, on the basis of an original MGB probe, an rna basic group is introduced into the rear half region of the primer for distinguishing SNP typing detection sites, and mutation design is introduced into the upstream of the RNA modified basic group for further improving the specificity of the reaction.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a kit for genotype detection of CYP3A5 polymorphism sites and a detection method thereof. Background technique [0002] There are many methods for the detection of CYP3A5*3 gene polymorphism, such as restriction length polymorphism analysis (RFLP), direct sequencing method, blot hybridization method, Taqman technology, allele-specific amplification method (ARMS), etc. . Among them, the most commonly used sequencing method can directly detect the position and type of the mutation site, but this method has cumbersome operation steps, long detection cycle, low sensitivity, and the amplification product is prone to contamination. [0003] For example, in the probe hydrolysis method, two different fluorescently labeled probes are added to the PCR reaction system, and they can be completely paired with the two alleles respectively. Normally, fluorescence is quenched due to th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/6858C12N15/11
CPCC12Q1/6858C12Q2531/113C12Q2535/137C12Q2561/101
Inventor 丁佳女郑宜文
Owner HANGZHOU KMB BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap