Oncolytic adenovirus recombinant carrying TMTP1 and tBid as well as construction method and application of oncolytic adenovirus recombinant

An oncolytic adenovirus and recombinant technology, applied in the field of medical genetic engineering, can solve problems such as the unfavorable killing effect of adenovirus, and achieve the effect of positive pharmaceutical value and broad social significance

Pending Publication Date: 2022-04-12
WUHAN KDWS BIOLOGICAL TECH CO LTD
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In most tumor cells, the receptor is in a low expression state, which is not conducive to adenovirus entering tumor cells to play a killing role.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Oncolytic adenovirus recombinant carrying TMTP1 and tBid as well as construction method and application of oncolytic adenovirus recombinant
  • Oncolytic adenovirus recombinant carrying TMTP1 and tBid as well as construction method and application of oncolytic adenovirus recombinant
  • Oncolytic adenovirus recombinant carrying TMTP1 and tBid as well as construction method and application of oncolytic adenovirus recombinant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Example 1: Construction of pAd5 / ΔE1A adenovirus packaging plasmid

[0060] Step 1.1: Construction of Shuttle Plasmid Blunt-Zero-E1A / ΔE1A

[0061] The pXC1-ΔE1A plasmid is a deletion of 27 bases in the 920nt-946nt region of the E1A conserved sequence 2 region of the human type 5 adenovirus gene, as shown in SEQ ID NO.1. Its construction method is as follows:

[0062] The pXC1 plasmid was purchased from Microbix Biosystem Inc. (Toronato, Ontario, Canada, Cat. No.: PD-01-03), which contains the human adenovirus type 5 (Ad5) 22nt-5790nt sequence. The 920nt-946nt region was deleted by 3 times PCR.

[0063] Acquisition of Fragment 1: Primer 1: 5′-cg ggatcc gggcccccatttcc-3' (SEQ ID NO 2), corresponding to 9883-9902nt, the underlined part is the BamHI restriction site; primer 2: 5'- gtcactgggtggatcgatcacctc cggtac-3' (SEQ ID NO 3), corresponding to 922nt-905nt, the underlined part is complementary to primer 3; PCR reaction was carried out with pXC1 as template, the total...

Embodiment 2

[0076] Example 2: Construction of pAd5 / ΔE1A / Hexon (HVR / TMTP1) plasmid vector

[0077] Step 2.1: Construction of the shuttle vector pEASY-Blunt-Zero-Hexon(HVR / TMTP1)

[0078] pBHGE3 was purchased from Microbix Biosystem Inc. (Toronato, Ontario, Canada, catalog number: PD-01-12), this plasmid contains the entire genome sequence except the Ad5 packaging signal (194-358nt). When pBHGE3 was obtained from MicrobixBiosystem Inc., the total amount was 10 μg. First, it was electroporated into competent bacteria, positive clones were picked, and plasmids were extracted. The obtained plasmids were purified by CsCl2-EB ultracentrifugation. Homologous recombination method to obtain Δ920-946Ad5 recombinant adenovirus construct, the method is as follows:

[0079] Plant 7.5×10 in a 15cm petri dish 5 293 cells, the culture medium is 10% FBS DMEM, by the next day, the cells should be 1-1.5×10 6 , about 70% of the cells were confluent; 3-4 hours before transfection, replace with fresh culture...

Embodiment 3

[0083] Example 3: Construction of Ad5 / ΔE1A / TMTP1 / ΔADP-tBid adenoviral vector

[0084] Step 3.1 Construction of adenovirus E3 region shuttle vector

[0085] Using the adenovirus Δ920-946Ad5 as a template (as described above, including the complete sequence of the adenovirus E3 region), a PCR reaction was carried out, the upstream primer: 5'-tgtcaccactaactgctttactcg-3' (SEQ ID NO 16), the downstream primer: 5'- gctgccctgcgtctttcta-3' (SEQ ID NO 17), the 26342-31140 fragment (ie the complete fragment of the E3 region) was obtained, which was ligated into the pEASY-Blunt-Zero vector to obtain the pEASY-Blunt-Zero-E3 plasmid.

[0086] Step 3.2: Plasmid pcDNA3.1-E3 / ΔADP is a backbone plasmid, in which the complete adenovirus E3 region is inserted but 29477bp-29714bp (the fragment between the two EcoRI restriction sites of adenovirus, ie the ADP region) is deleted, and Fragments with EcoRI restriction sites at both ends. Its construction method is as follows:

[0087] The Ad5 E3 r...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an oncolytic adenovirus recombinant carrying TMTP1 and tBid as well as a construction method and application of the oncolytic adenovirus recombinant, and belongs to the technical field of medical genetic engineering. According to the invention, 27 basic groups in a 920nt-946nt region are deleted in a second region of an E1A conserved sequence of a human type 5 adenovirus gene, a gene sequence for coding a tumor targeting peptide TMTP1 is inserted in a 19641nt-19655nt region of a Hexon hypervariable region 5, an E3 region is deleted in a 29477nt-29714nt region of an ADP gene to form a deletion region, a gene sequence of a mitochondrial apoptosis peptide tBid is inserted in the deletion region, and a Cla1 enzyme cutting site is introduced. The invention also discloses a construction method and application of the oncolytic adenovirus recombinant. The oncolytic adenovirus recombinant carrying the TMTP1 and the tBid disclosed by the invention has an ideal targeting effect and a strong killing effect.

Description

technical field [0001] The invention relates to an oncolytic adenovirus recombinant carrying TMTP1 and tBid, its construction method and application, and belongs to the technical field of medical genetic engineering. Background technique [0002] Gene therapy refers to the introduction of exogenous genes into target cells to correct or compensate diseases caused by gene defects or abnormal gene expression. As gene therapy vectors, oncolytic viruses have promising prospects for the treatment of malignant tumors. Among the vectors for oncolytic virus therapy, recombinant adenoviral vectors are the most widely used, and their clinical feasibility and safety have been recognized. The adenovirus gene therapy vector has the following biological advantages and clinical application advantages: (1) It has a wide infection spectrum, and can effectively attack cells derived from a variety of tissues, whether they are in the dividing or quiescent cells, and has an anti-cancer spectrum....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N7/01C12N15/12C12N15/861A61K48/00A61K38/17A61K35/761A61P35/00
Inventor马丁陈世民杨帆高庆蕾纪腾
OwnerWUHAN KDWS BIOLOGICAL TECH CO LTD