Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of arabidopsis seed regulatory gene RPP1A

A gene and seed technology, applied in the field of Arabidopsis thaliana seed regulation gene RPP1A in controlling seed size and 100-seed weight, can solve the problem that there is no report on RPP1A protein

Active Publication Date: 2022-04-12
INST OF SOIL SCI CHINESE ACAD OF SCI
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

P1 protein has multiple biological functions in protein synthesis, transcription control and DNA repair, but the function of RPP1A protein involved in seed size regulation has not been reported yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of arabidopsis seed regulatory gene RPP1A
  • Application of arabidopsis seed regulatory gene RPP1A
  • Application of arabidopsis seed regulatory gene RPP1A

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0016] Embodiment 1: T-DNA insertion homozygous mutant identification of Arabidopsis RPP1A gene

[0017] 1. Plant material

[0018] The seeds of the two T-DNA insertion mutants rpp1a-1 and rpp1a-2 of Arabidopsis RPP1A were purchased from the Arabidopsis Biological Resource Center (ABRC), and the storage numbers were SAIL_210_H01 and SALK_206736C, respectively. Such as figure 1 As shown, the T-DNA insertion site of the rpp1a-1 mutant is located in the promoter region, while the T-DNA insertion site of the rpp1a-2 mutant is located in the protein coding region, in the second exon region of the gene, and the wild-type Arabidopsis Col-0 was from our laboratory.

[0019] 2. Cultivation of Plant Material

[0020] Col-0, rpp1a-1, and rpp1a-2 were sterilized with 75% alcohol for 3 minutes, 0.5% sodium hypochlorite for 10 minutes, rinsed with sterile water for 5 times, vernalized at 4°C for 2 days, sowed on 1 / 2 MS medium, and exposed to light Box culture (16h light / 8h dark, 22°C) f...

Embodiment 2

[0035] Example 2: Semi-quantitative RT-PCR analysis of RPP1A gene T-DNA insertion mutants

[0036] In order to analyze whether the RPP1A gene is silenced in T-DNA insertion mutants, we performed semi-quantitative RT-PCR analysis, the specific method is as follows:

[0037] The total RNA of leaves of wild-type Arabidopsis Col-0, rpp1a-1, and rpp1a-2 plants was extracted by Trizol method, reverse-transcribed into cDNA, and the diluted cDNA was used as a template to perform PCR amplification with specific primers, respectively. The primer for Arabidopsis Actin.

[0038] The amplification primers are:

[0039] qPCR-RPP1AF:GGGGTACCATTTGATCCGTTTATACTTGTTATTG;

[0040] qPCR-RPP1AR:CAAAGAAGAAAGACAAGTGACTGCGT;

[0041] ActinF:GTTGGGATGAACCAGAAGGA;

[0042] ActinR: CTTACAATTTCCCGCTCTGC;

[0043] PCR reaction system

[0044]

[0045] PCR amplification conditions: pre-denaturation at 94°C for 3min; denaturation at 94°C for 30s, annealing at 55°C for 30s, extension at 72°C for 30s...

Embodiment 3

[0047] Example 3: Obtaining of transgenic plants complemented by RPP1A

[0048] 1. Cloning of the RPP1A gene

[0049] Using the CTAB method to extract the Col-0 genomic DNA, use the above DNA as a template, and use primers RPP1AF and RPP1AR containing restriction sites for PCR amplification. The amplification primers are:

[0050] RPP1AF:CCGGAATTCGTGTAATGTGTTTAATTACTTTTTGGT;

[0051] RPP1AR:CGCGGATCCTGGTAGAAAATAAACAAAATCAATTC;

[0052] PCR reaction system

[0053]

[0054] The PCR reaction program was: pre-denaturation at 94°C for 3 min; denaturation at 98°C for 10 s, annealing at 56°C for 15 s, extension at 72°C for 20 s, 35 cycles; extension at 72°C for 5 min.

[0055] The above-mentioned PCR amplification products were detected by 1% agarose gel electrophoresis, and a target fragment was recovered, connected to a carrier, transformed into E. coli competent cells, and a single clone was picked and sent for sequencing.

[0056] 2. Construction of recombinant plasmids ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to application of an arabidopsis seed regulatory gene RPP1A, in particular to application of the arabidopsis seed regulatory gene RPP1A in control of seed size and hundred-grain weight. The ribosome gene provided by the invention has homologous genes in all plants, and the gene from different plant sources is relatively conservative in evolution and has higher amino acid similarity; the RPP1A not only has the effect of regulating and controlling the size of seeds in arabidopsis thaliana, but also can be applied to the cultivation of new varieties of grain crops such as rice, wheat, corn and the like and economic crops such as oilseed rape, soybean and the like; the invention provides valuable gene resources for high-yield breeding of crops.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to the application of Arabidopsis thaliana seed regulation gene RPP1A in controlling seed size and 100-grain weight. Background technique [0002] Seed size is an important agronomic trait and a key component in determining crop yield (Zhang, Y. et al., Plant Cell, 2015, 27: 620-632). In angiosperms, a seed develops into a mature seed from double fertilization. The mature seed includes three parts: embryo, endosperm and seed coat. These three parts coordinate growth and regulation to determine the final size of the seed. Seed size is closely related to seed weight. In recent years, although people have made some progress in the molecular mechanism of seed size regulation, the signal pathways known to control seed size mainly include: IKU (HAIKU) pathway, ubiquitin-proteasome pathway, G (Guanosine triphosphate) protein Signaling pathways and mitogen-activated protein kinase...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82A01H5/10A01H6/20C12N15/29C07K14/415
CPCY02A40/146
Inventor 兰平李兵娟郑璐沈仁芳
Owner INST OF SOIL SCI CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com