Bacteria screening reagent, screening method, kit and application

A screening method and kit technology, applied in the direction of biochemical equipment and methods, microbial measurement/testing, etc., can solve the problems of inability to realize automatic replacement, increase throughput, disadvantages, etc.

Pending Publication Date: 2022-04-22
SHENZHEN READLINE BIOTECH CO LTD
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Due to the high-throughput and automation requirements of the R&D platform, the existing colony PCR technology is based on DNA gel electrophoresis because of its screening results, but this technology cannot be replaced by automation, and the screening methods of colony PCR and gel electrophoresis are time-consuming Longer, not conducive to improving throughput

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacteria screening reagent, screening method, kit and application
  • Bacteria screening reagent, screening method, kit and application
  • Bacteria screening reagent, screening method, kit and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] Embodiment 1 lysozyme breaks bacteria

[0068] Raw materials: Lysozyme is purchased from Yisheng (egg white extraction, crystal powder), and the enzyme activity is (20KU / mg);

[0069] Reagent pre-mixed: 20mM Tris-HCl (pH 7.5) 500mL, 1mg mL -1 Lysozyme Tris-HCl (pH 7.5) solution (10×), stored in refrigerator at 4°C, 10mM EDTA;

[0070] 1) Prepare 1× lysis reaction lysozyme solution: take 1mL 1mg mL -1 After mixing lysozyme Tris-HCl (pH 7.5) solution with 9mL 20mM Tris-HCl (pH 7.5), add 0.1mL 10mM EDTA to make a mixed solution;

[0071] 2) Take the bacterial solution and centrifuge to remove the supernatant, add 1× lysis reaction lysozyme solution 10 times the volume of the precipitate, and resuspend by pipetting;

[0072] 3) React at 37°C and 600rpm for 5 minutes;

[0073] 4) Obtain the mixed bacterial liquid after lysis.

[0074] Due to the release of a large amount of DNA from the broken bacteria, the reaction system is viscous, which is not conducive to the pipet...

Embodiment 2

[0081] Embodiment 2 fluorescence detection

[0082] Table 2 Reaction system test result statistics

[0083] reaction system Test Results System 1 - System 2 - System 3 - System 4 - System 5 + / - System 6 + / - System 7 +

[0084] Table 3 System 1

[0085]

[0086]

[0087] Table 4 System 2

[0088] Reagent Dosage final reaction concentration 1 μM crRNA 1μL 50nM 10nM Cas12a protein 1μL 0.2nM 1nM fluorescent reporter 1μL 0.1nM 10*Buffer 2μL - ddH2O 13μL - Mixed bacteria 2μL -

[0089] Table 5 System 3

[0090] Reagent Dosage final reaction concentration 1 μM crRNA 2μL 100nM 10nM Cas12a protein 1μL 0.2nM 1nM fluorescent reporter 1μL 0.1nM 10*Buffer 2μL - ddH2O 12μL - Mixed bacteria 2μL -

[0091] Table 6 System 4

[0092] Reagent Dosage final reaction concentration ...

Embodiment 3

[0104] Embodiment 3 crRNA design

[0105] Different screening genes design different crRNAs. Select the PAM site (TTTN) on the target gene, select the 20bp base sequence after this site as the recognition sequence, and design crRNA.

[0106] 5′UAAUUUCUACUAAGUGUAGAU GAUUGCCGGACCCGGACCGC3 '(as shown in SEQ ID NO:1)

[0107] Wherein: the non-underlined part is the structural sequence, and the underlined part is the recognition sequence.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of bacterial colony screening, in particular to a bacterium screening reagent, a screening method, a kit and application. The invention provides a bacteria dissolving reagent, which is prepared from the following components: 10 to 30 mM of Tris-HCl, 10 to 20 mM of EDTA (Ethylene Diamine Tetraacetic Acid) and 0.01 to 0.55 mg / mL of lysozyme. According to the invention, the CRISPR Cas12a technology is applied to bacterial colony screening for the first time, and is improved and optimized based on the technical principle, so that the CRISPR Cas12a technology is more suitable for high-throughput screening. In plasmid design, a PAM sequence is introduced to the tail end of a gene, so that all crRNA sequences can simultaneously recognize a gene segment and a vector segment. In addition, automatic equipment and a large-batch screening reaction system and reaction conditions are utilized, so that the method is fully suitable for an automatic implementation scheme of bacterial colony screening, the screening time is greatly shortened, and the strain breeding speed and the strain screening efficiency are greatly improved.

Description

technical field [0001] The invention relates to the field of bacterial colony screening, in particular to bacterial screening reagents, screening methods, kits and applications. Background technique [0002] During the transformation of engineering bacteria, it is often necessary to screen out positive monoclonal colonies for further transformation and cultivation. Among the existing methods, colony PCR is widely used as the fastest and most convenient screening method in the screening of positive single clones of engineering bacteria. For fungi, due to their cell wall and chromosome structure, sample pretreatment is required when performing colony PCR: take 1.5mL of yeast strains in logarithmic growth phase, centrifuge at 13000r / min for 15s, remove the supernatant, and double steam Wash once with water, centrifuge at 13,000r / min for 15s, suspend the precipitate in 20μLTE buffer, boil in boiling water for 1-10min, cool in ice for 10min, centrifuge at 13000r / min for 5min, st...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/689C12Q1/6806C12Q1/6816
CPCC12Q1/689C12Q1/6806C12Q1/6816C12Q2521/531C12Q2527/125C12Q2521/327C12Q2525/161C12Q2563/107Y02A50/30
Inventor黄鹤赵弘方欣于铁妹潘俊锋刘建
OwnerSHENZHEN READLINE BIOTECH CO LTD