ELISA (Enzyme-Linked Immunosorbent Assay) detection method of avian exosome
A detection method, exosome technology, applied in the direction of measuring devices, biological testing, material inspection products, etc., can solve the problems of cumbersome operation, different sensitivity, complicated steps, etc., and achieve the effect of large application prospect and wide application range
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0067] The ELISA detection method of poultry-derived exosomes provided in this application uses poultry-derived CD63 as the target, so it is first necessary to prepare relevant recombinant proteins for subsequent detection and application. Therefore, this example first introduces the preparation process of related recombinant proteins as follows.
[0068] (1) Design primers and carry out PCR amplification
[0069] According to the existing poultry CD63 sequence, the coding sequence (2142bp, as shown in SEQ ID No.1) was redesigned as follows by optimizing the codons, excising the signal peptide, and introducing XhoI and NheI restriction sites and His tags at the same time:
[0070]GCTAGCATGGAGGAACTCCGCGTTGCGTTTTCTATTCTGGTACTGTGTGCCGCAGGTTCTTGGGGTTCCAACATTTGTGCAACTCGTGGCGTGACCTCTTGTAAACAGTGCCTGGCTGTTTCTCCGCTGTGTGCATGGTGCTCCGCCGAAGTTGTTGCCCAGTCTACCCCACGTTGCGATCTGTTCGCAAACCTGCTGCAGAACGGTTGCGGTCGTGATTTTATTGAATTCCCGCGTTCTTCCATCACGGTTCTGGAAGAACGTCCACTGTCCGATAAAGGTTCCGGCGGTAGCACTACCAC...
Embodiment 2
[0090] Using the CD63 protein and its corresponding antibody prepared in Example 1, the inventors further drew a standard curve.
[0091] (1) Sample preparation
[0092] Collect the serum-free supernatant of cells from healthy chickens, centrifuge at room temperature (25°C) and 2000g for 15 minutes to remove cells and their debris, and keep the supernatant;
[0093] Centrifuge the supernatant after the above centrifugation at 4°C and 100,000g for 60 minutes, and leave the precipitate (the retained precipitate is poultry-derived exosomes);
[0094] Resuspend the pellet (exosomes) with PBS (pH 7.0), and the prepared resuspension is the exosome resuspension;
[0095] Dilute the obtained exosome suspension into standard products with different concentrations according to the 10-fold serial dilution method;
PUM
Property | Measurement | Unit |
---|---|---|
Diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap